Labshake search
Citations for Bio-Rad :
701 - 750 of 4928 citations for 6 BROMOPYRIDO 2 3 D PYRIMIDINE 2 4 1H 3H DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: 2 ⨯ 106 CAR T cells collected after 24-day expansion were resuspended with 1 ⨯ Laemmli sample buffer (BIORAD) containing 2.5% β-mercaptoethanol before sonication with 50% amplitude in Sonic Dismembrator (FisherBrand) ...
-
bioRxiv - Bioengineering 2021Quote: ... First strand cDNA was synthesized utilizing 2 µg of total RNA and iScriptTM cDNA Synthesis Kit (Bio-Rad). A fraction (0.75 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 uL of bacterial culture was mixed with 10 uL 2X Sso Fast Evagreen qPCR mixture (BioRad USA). The primers were mixed into an equal forward/reverse (F/R ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total RNA was used for cDNA preparation using the iScript cDNA synthesis kit (Bio-Rad). A 1/10 dilution of cDNA was used for qRT-PCR analysis using the FastStart Universal SYBR Green Master Mix (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were transferred to a nitrocellulose membrane for 2 hours in a wet blot tank system (Bio-Rad), and membranes were blocked with 5% skim milk for 30 min at room temperature before incubating with primary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... using primers specific for fathead minnow β-actin (Table 2) with iTaq universal SYBR green supermix (Bio-Rad).
-
bioRxiv - Bioengineering 2022Quote: ... ddPCR reactions were set up as follows: 11 μL 2×ddPCR™ supermix for probes (no dUTP) (BioRad), 0.2 μL FWD primer (100 μM) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR products were confirmed by 2% agarose gel electrophoresis stained with GelRed using a 50 bp marker (BioRad). PCR products were normalized using Mag-bind Total Pure NGS ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2×106 cells (extracted tissues or cell culture) were suspended in 50 μL RIPA (Radio ImmunoPrecipitaion Assay; BioRad) lysis buffer containing 200 mM PMSF (Alpha-Phenyl Methyl Sulfonyl Fluoride ...
-
bioRxiv - Genomics 2022Quote: ... These products were analyzed on a 2% agarose gel and was imaged with Gel Doc imaging system (BioRad). The observation of multiple bands implied successful targeting of the sequences by the sgRNA.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed on 2 μl with the SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) and the following primer pairs ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were resuspended in agarose insert buffer and mixed 1:1 with 2% low-melting agarose (Bio-Rad). Gel inserts were solidified at 4°C for overnight and were stored in agarose insert buffer until analysis ...
-
bioRxiv - Systems Biology 2019Quote: ... 272 mM sucrose) were mixed with 2 µg of DNA in a 1mm gapped electroporation cuvette (Bio-Rad). Cells were incubated on ice for 15 min and electroporated using the Gene Pulser XCell™ electroporation system (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... Both PK-treated and untreated samples were then mixed 1:2 with 4X Laemmli sample buffer (Bio-Rad) containing DTT ...
-
bioRxiv - Genetics 2019Quote: ... The resulting cDNA was PCR amplified and run on a 2% Certified Low Range Ultra Agarose (Bio-Rad) gel with subsequent extraction using the QIAquick® Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and then the WBC solutions were embedded into 2% agarose plugs (CHEF Genomic DNA Plug Kit, Bio-Rad) to avoid fragmentation of long DNA molecules ...
-
bioRxiv - Developmental Biology 2020Quote: ... Smit1/2 and TonEBP were measured by real time qPCR using SYBR Green I (Bio-Rad, Mississauga ON) and 5 μM of forward and reverse primer mix (Bio-Rad CFX384 ...
-
bioRxiv - Genetics 2021Quote: ... The enriched proteins were dissociated by the addition of 2 x Laemmli sample buffer (161-0737, Bio-Rad) and boiled at 95 °C for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... Gels were dried for 2 h at 80°C and analysed on a Personal Molecular Imager (Bio-Rad). For RNA stability assays ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μl of RNA were mixed with 2 μl of 50 μM oligo dT primer (Bio-Rad, 1725038) and 1 μl of 25 mM dNTP mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-tubulin YL1/2 from rat (MCA77G, Bio-Rad AbD Serotec, at 1:2000 dilution for IF), anti-rabbit Alexa Fluor 488 (A11008 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Genetics 2019Quote: ... the size of the amplicon was determined by comparison with a 2-kb DNA marker with the use of Quantity One software (version 4.6.7; Biorad), and the number of repetitions was estimated by comparing the size of the product amplified from the Nichols strain ...
-
bioRxiv - Plant Biology 2022Quote: ... For α-ACTIN-2 the secondary antibody Goat Anti-Mouse IgG (H + L)-HRP conjugate (1706516, Bio-rad) was used at a dilution of 1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Captured proteins were separated from beads by incubating beads in 50 μl 2× Laemmli Sample Buffer (Bio-Rad) at 95°C for 25 min ...
-
bioRxiv - Immunology 2022Quote: ... 200 μL of this transformation mix was then aliquoted into pre-chilled 2 mm electroporation cuvettes (Bio-Rad) and electroporated at 1500 V with an average time constant of ∼4.5 ms using a Gene Pulser Xcell Electroporation System (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... Protein samples were suspended in Laemmli Sample Buffer supplemented with 2-Mercaptoethanol (β-mercaptoethanol) (BioRad Hercules, California – USA). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR was performed using the Promega 2-step kit on a CFX96 Real-Time PCR System (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated to 50°C for 2 min before addition of 40 µl molten CleanCut agarose (Bio-Rad 1703594), vortexing vigorously for 5 s before pipetting in plug mould (Bio-Rad 1703713 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 ug RNA was used to synthesize cDNA with the iScript™ cDNA Synthesis Kit (Bio-Rad 1708890). The SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad 1725271 ...
-
bioRxiv - Physiology 2023Quote: ... and samples of four larvae each were homogenized in 100 μl 2× SDS sample buffer (Bio-Rad #1610737) containing 5% (355 mM ...
-
bioRxiv - Immunology 2023Quote: ... unreacted ITC-DTPA was removed by dialysis against 0.25 M ammonium acetate (NH4Ac) pH 5.4–5.5 (metal free) supplemented with 2 g/L Chelex (Bio-Rad) using 20,000 molecular weight cut-off dialysis cassettes (Slide-a-Lyzer ...
-
bioRxiv - Biochemistry 2023Quote: ... The detergent was removed by three 2-hour incubations with ∼33 mg of Bio-Beads SM2 (Bio-Rad) followed by overnight incubation with ∼50 mg of Bio-Beads SM2 with all incubations occurring at 4°C.
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized from total RNA (1-2 μg) with iScript Advanced cDNA Synthesis Kit (Bio-Rad; 1725038). Quantitative RT-PCR (qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using 2 μg of total RNA and the iScript cRNA synthesis kit (Bio-Rad). qPCR was performed using the Brilliant III ultra-Fast SYBR green qPCR master mix (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were added with equal volume of 2× Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA, USA) containing 65.8 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was transferred to an ice-cold 2 mm gap electroporation cuvette (Bio-Rad Laboratories GmbH, Germany), and cells were electroporated with a single pulse at 1.8 kV ...
-
bioRxiv - Genomics 2023Quote: ... Gene panel probe hybridization occurred overnight for 18 hours at 50°C (Bio-Rad DNA Engine Tetrad 2). Subsequent washes the next day removed unbound probes ...
-
bioRxiv - Genetics 2023Quote: ... 1 ml 2xYNB with 2% glucose was added to the sorted cells in sheath fluid (PBS, BioRad #12012932) and they were transferred to a shaking incubator and grown at 30 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of total RNA was used for cDNA preparation using the iScript cDNA Synthesis Kit (Bio-Rad). A 1/10 dilution of the cDNA was then used for qRT-PCR analysis utilizing the SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2020Quote: ... the 96-well microplate was incubated at 37 °C for 1h and the end-point image was taken by ChemiDoc™ MP Imaging System (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibody incubation was done at room temperature for 1h (HRP-conjugated goat anti-rabbit IgG, 1:2000 dilution, Bio-Rad, 403005). Membranes were washed with Tris-buffered saline containing 0.05% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... the indicated ESA supernatant was boiled in SDS-PAGE sample buffer and 3 μg of each sample was run with a 4-15% TGX gradient gel (Bio-Rad cat. no. 4561086), then transferred to a nitrocellulose membrane ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cancer Biology 2024Quote: ... PAGE gels were run at 130V for ∼1h in Bis-Tris buffer (GeneScript) and then wet transferred to a 0.2 µm PVDF membrane (BioRad, activated in 100% methanol) at 100V for ∼1 h in 1X transfer buffer containing 20% methanol ...
-
bioRxiv - Cell Biology 2020Quote: ... were harvested and resuspended in 1X PBS-NaN3 (0.2%) and embedded in 2% low-melt agarose (Mb grade, BioRad). Agarose plugs were chilled at 4°C for 30 min and then ejected into Proteinase K digestion buffer (1 mg/mL proteinase K ...