Labshake search
Citations for Bio-Rad :
701 - 750 of 6219 citations for 3 Acetyl 5 4 chlorophenyl 2 methylfuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Resulting lipopolysaccharides were separated using gradient 4–20% sodium dodecyl sulfate□polyacrylamide gel (4–20% Mini□PROTEAN® TGX™ Precast Protein Gel, BioRad, Hercules, USA) electrophoresis (SDS□PAGE ...
-
bioRxiv - Neuroscience 2023Quote: 15-20 µg of protein were loaded onto 4-12% Bis-Tris gels (Novex, Cat. no: NP0336BOX) or 4-20% Tris-Glycine extended gels (BIO-RAD, Cat. no: 4561095) for separation and transferred to nitrocellulose or methanol activated PVDF membranes ...
-
bioRxiv - Cell Biology 2024Quote: ... SDS-PAGE was performed either with standard gels (10 – 12% acrylamide depending on protein size with a 4% acrylamide stacking gel) or 4-15% Mini-Protean TGX precast protein gels (Bio-Rad, Hercules, CA, USA) for CRY1 and Histone at constant 160 V ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Biophysics 2024Quote: ... The membrane was blocked by dipping in 3% skimmed milk (Bio-Rad) in PBS containing 0.1% Tween 20 (Amresco ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...
-
bioRxiv - Neuroscience 2024Quote: ... Each fraction is run through a 3-15% gradient gel (BioRad 45610840) alongside full keratinocyte cell lysate (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and filtered 3 times through gel filtration biospin P30 (Bio-Rad France). The purified NAMPT was then transferred to NAMPT elisa wells for quantitation as described in experimental section ...
-
bioRxiv - Biophysics 2024Quote: ... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on 4-20% gradient gels (BioRad 4561096).
-
bioRxiv - Biophysics 2021Quote: ... Purity was confirmed by SDS-PAGE (4 – 20% TGX, BioRad).
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were loaded to 4-15% polyacrylamide gels (Bio-Rad) for electrophoresis ...
-
bioRxiv - Cancer Biology 2021Quote: ... and separated on 4-15% Protein Gels (BioRad, Cat# 4568084). SPOP protein was probed by using in-house made rabbit anti-SPOP (1:1000) ...
-
bioRxiv - Genetics 2021Quote: ... ran on a 4%-20% polyacrylamide gel (Bio-Rad, #4561096), and transferred to an Immobilon-P polyvinylidene fluoride (PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were loaded onto a 4-12% polyacrylamide gel (BioRad) and electrophoresed at 150V for 10 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... lysates were loaded on 4%–20% polyacrylamide gels (Bio-Rad) and transferred onto a nitrocellulose membrane (Whatman ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°C in a Mini Trans-Blot Cell (Bio-Rad). Membranes were blocked in 3% non-fat dry milk in TBS-T buffer for 30 min at room temperature ...
-
Mapping of the autophagosomal degradome identifies IL-7Rα as key cargo in proliferating CD4+ T-cellsbioRxiv - Immunology 2021Quote: ... 4–20% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) with Tris/Glycine/SDS running buffer (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... Proteins were resolved on 4 – 20% SDS-PAGE gels (BioRad), transferred to a PVDF membrane (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and cooled to 4°C using a thermal cycler (Biorad). Next ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein samples were separated via 4-15% SDS PAGE (BioRad) and transferred to a PVDF membrane using the BioRad Turboblot system ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were run on 4-20% Tris Glycine gels (BioRad) and transferred via Wet transfer onto PVDF membranes for immunoblotting with the indicated antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated in 4-20% SDS-PAGE gels (BioRad) and transferred to nitrocellulose membranes using Trans-Blot® Turbo™ system (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... then separated using 4-15% gradient SDS-PAGE (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... SDS-PAGE was performed using 4-20% polyacrylamide gels (BioRad) electrophoresed at 120V for 60 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-20% Criterion TGX Stain-Free Precast gels (BioRad) in Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were fractionated on a 4-15% gel (BioRad) and the gels were stained using PageBlue protein staining solution (Fermentas).
-
bioRxiv - Microbiology 2020Quote: ... Protein samples were mixed with 4× Laemmli buffer (Bio-Rad), denatured at 70°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were run on a 4-15% PAA gel (BioRad) under reducing conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... and densitometry performed using Image Lab software (ver 4, BioRad)
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run on 4-15% gradient gels (Bio-Rad) at 80-120V and transferred onto PVDF membrane (Immobilon-FL ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded on 4-20% CriterionTM TGXTM gels (Bio-Rad) and migration was performed in a 1X tris-glycine buffer (Bio-Rad ...