Labshake search
Citations for Bio-Rad :
7101 - 7150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and protein concentration was determined by Bradford Assay (Bio-Rad, #5000205). 25 mg of resuspended ribosome pellet was digested with trypsin at a [20:1] protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... and protein concentration was determined via Bradford Assay (Bio-Rad, #5000205).
-
bioRxiv - Molecular Biology 2024Quote: ... Live cell counting and assessment of sample concentration and viability were performed using an automated cell counter (TC20TM, Bio-Rad Laboratories, Inc., Hercules, CA, USA). The qualified cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... protein concentration was determined by Bradford colorimetric method (BioRad #5000006). Total proteins (20 μg ...
-
bioRxiv - Molecular Biology 2024Quote: ... boiled for 10 min at 95°C and examined by western blot using 4-15% Mini-PROTEAN TGX precast protein gels (BioRad #4561083). After blocking step with 10% non-fat milk for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500ng of RNA has been diluted in 250 μl of TE low EDTA buffer and applied to pre-equilibrated positively charged nylon membrane (Amersham Hybond-N+ # RPN203B) on Slot blot apparatus (Biorad # 1706542) by gentle vacuum ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qRT-PCR was performed on the CFX96 Real-Time PCR Detection System (Bio-Rad) using All-in-One SYBR® Green qPCR Mix (GeneCopoeia ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total proteins (20 μg) of whole cell extracts were resuspended in 1x LAemmli Buffer (BioRad #1610747), boiled for 10 min at 95°C and examined by western blot using 4-15% Mini-PROTEAN TGX precast protein gels (BioRad #4561083) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The proteins were transferred to a nitrocellulose membrane (Bio-Rad) and subsequently detected by anti-GFP rabbit polyclonal antibody (Novus Biologicals #NB600-308 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The His::STL-1 was purified using Nuvia IMAC column (Bio-Rad) in the presence of washing buffer (20 mM HEPES ...
-
bioRxiv - Molecular Biology 2024Quote: ... The worm lysates were separated on 4–15% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS PAGE) (Bio-Rad). The proteins were transferred to a nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: One-day-old adult hermaphrodites were lysed in the Laemmli sample buffer (Bio-Rad) supplemented with the reducing agent β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and DRIP-qPCR were carried out by qPCR in the CFSX384 instrument (Biorad) using Brilliant III Ultra-Fast SYBR QPCR MM (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... the target tag-SLO protein underwent Ni2+-IMAC resin (Bio-Rad) purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentration was quantified by using the Bradford assay kit (Bio-Rad, Munich, Germany) and adjusted to 0,2 mg/mL ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with iScript cDNA Synthesis Kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Pla2g4a and Actin B cDNA levels in the hypothalamus were measured by ΔΔCt method using SYBR Green reagent (Bio-Rad, Hercules, CA). The information on primers is shown in table S1 ...
-
bioRxiv - Neuroscience 2024Quote: ... The iTaq Univer SYBR Green Supermix was purchased from Bio-Rad. The thermal cycling amplification conditions were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 1 µg of total RNA using an iScript reverse transcriptase cDNA synthesis kit (Bio-Rad) to amplify all genes ...
-
bioRxiv - Neuroscience 2024Quote: ... using a Trans-Blot Turbo Transfer System (Trans-Blot ®TurboTM, Bio-Rad) according to manufacturer’s specifications (20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were performed in two technical replicates using SYBR Green Mix and the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). RT-qPCR primer sequences are listed in Table 1.
-
bioRxiv - Molecular Biology 2024Quote: ... Protein concentration was measured by Bradford assay (Bio-Rad) and 80-100 μg of total protein was used per lane ...
-
bioRxiv - Microbiology 2024Quote: ... The incubations with 40 mg/mL Blotting-Grade Blocker (BioRad, Hercules, CA, USA) as blocking buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatants were collected and analyzed for protein concentration using the Bio-Rad Protein Assay Dye (Bio-Rad). 20-50 mg of protein was denatured at 95°C for 5 min in 5x SDS sample buffer (250 mM Tris-HCl pH 6.8 ...
-
bioRxiv - Microbiology 2024Quote: ... using a thermocycler (Biorad) and stored at -20°C until further use ...
-
bioRxiv - Microbiology 2024Quote: Proteins were transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad, Hercules, CA, USA) and then blocked with 5% (w/v ...
-
bioRxiv - Microbiology 2024Quote: ... Ten microliters of sample were run on an Any-Kd Mini-PROTEAN TGX Precast gel (Bio-Rad) and then transferred to a Mini-size PVDF membrane (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... ICP1 genome replication was measured with primers Zac68(CTGAATCGCCCTACCCGTAC)/69 (GTGAACCAACCTTTGTCGCC) using iQ SYBR Green Supermix (Bio-Rad) and the CFX Connect RealTime PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by real-time RT-PCR targeting highly conserved regions of the IAV matrix (M) (10) using iTaq Universal Probes One-Step Kit (Bio-Rad, 1725141, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended to OD 10 in 1X Laemmeli Buffer supplemented with 2-mercaptoethanol (10%) (Bio-Rad) and boiled at 99°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... at a 1:3000 dilution and a secondary goat α-rabbit-HRP antibody (Bio-Rad) at a 1:10000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... and then transferred to a Mini-size PVDF membrane (Bio-Rad) using a Trans-Blot Turbo system (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... and imaged using a Chemidoc XRS imaging system (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... 10 μg capped RNAs were next delivered to cells by electroporation using a Gene Pulser X cell 617BR 11218 (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... Blots were developed using Clarity Western ECL substrate (Bio-rad) and imaged using a Chemidoc XRS imaging system (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... using a Trans-Blot Turbo system (Bio-Rad). Proteins were detected using a primary α-Flag antibody (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... with the percentage of bound substrate quantified using ImageLab software (Bio-Rad, Hercules, CA, USA). Values were plotted against total protein concentration to determine KD values using non-linear regression fit in Prism software (GraphPad ...
-
bioRxiv - Microbiology 2024Quote: ... and elutions were mixed with 4x Laemmli sample buffer (Bio-Rad), boiled ...
-
bioRxiv - Microbiology 2024Quote: ... The protein concentrations were calculated using a protein assay kit (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was done using the iTaq Universal SYBRGreen Supermix kit (Biorad) following the vendor protocol ...
-
bioRxiv - Microbiology 2024Quote: ... coli were conducted on a CFX96 Touch™ Real-Time PCR System as previously described (Bio-Rad). Each well included a 25 µl reaction mixture with 1 µl of DNA ...
-
bioRxiv - Microbiology 2024Quote: ... The droplet-partitioned samples were loaded in a 96-well plate and heat-sealed with a PCR plate heat-seal foil (Bio-Rad, Hercules, CA, USA). The plate was transferred in a thermal cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The ddPCR reaction mixture was composed of 5 µL ddPCR Multiplex Supermix (Bio-Rad, Hercules, CA, USA), 0.9 µM of each primer ...
-
bioRxiv - Microbiology 2024Quote: ... The amplified samples were loaded onto a droplet reader (Bio-Rad, Hercules, CA, USA) for data quantification ...
-
bioRxiv - Microbiology 2024Quote: ... The plate was transferred in a thermal cycler (Bio-Rad, Hercules, CA, USA) for PCR amplification ...
-
bioRxiv - Microbiology 2024Quote: ... ddPCR data was processed using QuantaSoft™ Software version v1.7.4 (Bio-Rad, Hercules, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... Complementary DNA (cDNA) was synthesized using a Qscript kit (QuantaBio, MA) as per kit instructions in a T-100 (Bio-Rad) thermocycler.
-
bioRxiv - Microbiology 2024Quote: ... An automatic droplet generator was used to perform the droplet generation (Bio-Rad, Hercules, CA, USA). The droplet-partitioned samples were loaded in a 96-well plate and heat-sealed with a PCR plate heat-seal foil (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-5 µg of the non-denatured protein samples were diluted 1:1 with the native sample buffer (BIO-RAD #161-0738) and loaded into the polymerized gel ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification of gene expression was performed by qPCR using Itaq Universal SYBR Green Supermix (Bio-Rad). GAPDH was used as an internal reference for normalization ...