Labshake search
Citations for Bio-Rad :
651 - 700 of 2175 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Real time PCR (qRT-PCR) was performed with SYBR Green PCR reaction mix (BioRad) using ABI Fast 7500 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... reactions were analysed by SDS-PAGE and transferred to polyvinylidene difluoride membranes (Bio-Rad) using the Trans-Blot® Turbo− transfer system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2021Quote: ... and quantitative PCR reactions were done using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) in a CFX96 Touch device (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... The reactions were run in a CFX96 REAL-Time PCR Detection System (Bio-Rad). The relative expression level of the target genes was analysed with the delta-delta Ct method and normalized to the expression level of ACT7 ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR (qRT) reactions were performed using iQ SYBR Green Supermix (Bio-Rad) and an CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture (20 µL) contained 10 µL iQ SYBR Green Supermix (Bio-Rad), 2 µL each of forward and reverse primers to a final primer concentration of 100 nM each except for the assay for L ...
-
bioRxiv - Plant Biology 2020Quote: ... Reverse transcriptase (RT) reactions were performed using iScript cDNA Synthesis Kit (Bio-Rad, USA) and 1 μg of total RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR reaction mixtures consisted of 5 μl iQ SYBR Green supermix reagent (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative PCR reactions were performed using SsoAdvanced Universal Sybr Green Supermix kit (Bio-Rad), and analyzed using CFX96 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... then a qPCR reaction (iTaq Universal SYBR Green Supermix, BioRad, Rishon Le Zion, Israel) using either a human specific primer or a primer designed to detect both human and mouse cells ...
-
bioRxiv - Microbiology 2022Quote: ... the reactions were quenched by adding 10 μL 2x Laemmli sample buffer (Bio-Rad). The samples were then loaded onto a 4-20% Mini-PROTEAN TGX Precast Protein gel (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried using CFX Connect Real Time PCR Detection System (BioRad; Hercules, CA) as follows ...
-
bioRxiv - Genetics 2022Quote: ... qPCR reactions were prepared with SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Catalog #1725271) using cDNA and the following primers (final concentration ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried out using the CFX Opus 96 Real-Time PCR System (BioRad). Expression of deGFP was calculated relative to the no acetyl phosphate control.
-
bioRxiv - Microbiology 2022Quote: ... The reaction was performed on a CFX96 Touch Real-Time PCR System (Bio-Rad) using the following steps ...
-
bioRxiv - Immunology 2022Quote: ... in a reaction-volume of 25 µl with 12.5 µl iQTM SYBR Green (Biorad), 2 µl template DNA and 0.75 µl primers (10 µM) ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... Quantitative RT polymerase chain reaction (PCR) was performed using the CFX96 RealTime System (BioRad) with LightCycler FastStart DNA Master plus SYBR Green I (Roche Diagnostics ...
-
Variation in Leishmania chemokine suppression driven by diversification of the GP63 virulence factorbioRxiv - Microbiology 2021Quote: ... qPCR reactions were performed using the iTaq Univeral SYBR Green Mastermix (BioRad, 172-5124) with 50nm of each primer and 4μl of cDNA for gene targets or 4μl of cDNA for housekeeping genes in a final reaction volume of 10μl ...
-
bioRxiv - Neuroscience 2021Quote: ... The qPCR reactions were carried out using the C1000 Touch™ Thermal Cycler (BioRad) and the SYBR fluorescent data collected using the CFX96 Optical Reaction Module for Real-Time PCR Systems (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: The qPCR reaction was prepared with iQTM SYBR Green Supermix kit (Bio-Rad, USA) then detected by C1000 Touch™ Thermal Cycler (Bio-Rad CFX96 Real-Time system ...
-
bioRxiv - Microbiology 2021Quote: ... the reaction was quenched by adding 10 µL 2x Laemmli sample buffer (Bio-Rad). The samples were then loaded onto a 4-20% Mini-PROTEAN TGX Precast Protein gel (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reactions were prepared in a 96-well plate (Bio-Rad, CA, USA). The plate was placed on a AutoDG (Bio-Rad ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR reaction contained 10 μL of 2x QX200 ddPCR EvaGreen Supermix (Bio-Rad), 100 nM forward primer (CTTCTTGCATTCTCCTCATTTCCTC ...
-
bioRxiv - Bioengineering 2021Quote: ... or using 5 μL reaction volume in a C1000 Touch thermal cycler (Bio-Rad). The PCR program was ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Reactions were amplified using a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) with the following PCR cycling conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis was performed by adding 2uL 5X iScript reaction mix (Bio-Rad, 1708889) to 50ng RNA ...
-
bioRxiv - Genomics 2022Quote: ... The reaction was cleaned up by ethanol precipitations and P4 beads (Bio-Rad, #1504124) spin columns ...
-
bioRxiv - Developmental Biology 2022Quote: ... Standard protocol qPCR reaction was run using SsoFast EvaGreen Supermix (Bio-Rad, 172-5202) on a Bio-Rad CFX96 Real-Time Systems ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Reactions were incubated in a CFX96 Touch Real-Time PCR detection system (Bio-Rad) by the following program ...
-
bioRxiv - Neuroscience 2020Quote: A 20 μl reaction volume containing 10 μl of 2X iQ Multiplex Powermix (Biorad), 0,60 μl of primers (10 μM) ...
-
bioRxiv - Developmental Biology 2020Quote: ... qPCR reactions were performed using Bio-Rad SYBR Green Supermix (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Real-time PCR reactions were performed using soAdvanced Universal SYBR Green Supermix (Bio-Rad) with cDNAs synthesized from iScript Advanced cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: Digital Droplet Polymerase Chain Reaction (ddPCR) was performed following manufacturer’s instructions (Bio-Rad, Australia). A 20 µl reaction was assembled with primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 μL ddPCR reaction mixture contained 1× ddPCR master mix (Bio-Rad, USA), 0.9 μM primers ...
-
bioRxiv - Genetics 2020Quote: ... The binding reactions were resolved in 5% nondenaturing TBE pre-cast gel (Bio-rad) using Mini-PROTEAN® Electrophoresis System (Bio-rad ...
-
bioRxiv - Immunology 2020Quote: ... and specific RNA specimens were quantified by PCR reaction using SYBRgreen Supermix (Bio-Rad) on the QuantStudio7 Flex real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: All reactions were performed on a CFX96 Touch instrument (Bio-Rad, Hercules, CA, USA) using Luna Universal Probe One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... All PCR reactions were conducted using the Bio-Rad CFX-96 (Bio-Rad, USA). All data were normalized against endogenous GAPDH controls of each sample ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were performed in a CFX96 real-time PCR detection system (Bio-Rad) containing 100 ng of cDNA template (2 μL) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad). The ΔΔCq method was applied to quantify the relative expression of genes ...
-
bioRxiv - Microbiology 2021Quote: ... Reaction mixtures contained 1X SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Inc., Hercules, CA), 600 nM (each ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR reactions were performed on a CFX96 thermal cycler (Bio-Rad, Mississauga, ON). Experiments were performed with at least 2 technical replicates to monitor variation between wells ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR reaction was performed on CFX Connect Real-Time System (Bio-Rad Laboratories) using SYBR-Green based detection system with QuantiNova SYBR green PCR Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions (25 μL, triplicate) used iTaq Universal Green SYBR Mix (Bio-Rad, Hercules, CA) in a C1000 Touch Thermal Cycler/CFX96 Real-Time System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR reaction was conducted using iProof master mix (X2) (Bio-Rad; 172-5310), 1-1.5μl of Forward and Reverse primers and 50ng of lenti-sgRNA plasmid (Addgene ...
-
bioRxiv - Genomics 2021Quote: These reactions were undertaken on a DNA Engine Tetrad 2 Thermal Cycler (Bio-Rad), with MyTaq HS DNA polymerase ...
-
bioRxiv - Genomics 2020Quote: ... Reactions and data collection were performed on a C1000 Real Time Thermocycler (Bio-Rad), with initial 3 min 95°C denaturation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR reactions were conducted in triplicate using the CFX96 Real-time System (BioRad) under the cycling conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... Reactions were run on a CFX 384 Real-Time PCR detection system (Bio-Rad) in three technical replicates as follows ...