Labshake search
Citations for Bio-Rad :
651 - 700 of 5783 citations for 7 Hydroxy 2 3 dihydro 1H cyclopenta c chromen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Densitometry was performed using Quantity One 4.6.9 software (Bio-Rad).
-
bioRxiv - Bioengineering 2019Quote: ... with cumulative image recording using the Quantity One software (Biorad).
-
bioRxiv - Cancer Biology 2019Quote: ... then one hour and twenty minutes at 120 volts (Biorad) at 4oC ...
-
bioRxiv - Plant Biology 2020Quote: ... radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Densitometric scans were analyzed using Quantity One software (Bio-Rad). The value of the ricin band was determined as a percentage of the total protein in each lane ...
-
bioRxiv - Genetics 2021Quote: ... were quantified with Quantity-One software (Bio-Rad Laboratories, America). Sample in western blot was triplicate.
-
bioRxiv - Cancer Biology 2021Quote: ... The iTaq Universal SYBR Green One-Step Kit (Bio-Rad) was used to run the RT-qPCR reactions ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Neuroscience 2023Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Biophysics 2020Quote: ... The supernatant was incubated with amylose resin for 1 h at 4°C and loaded onto a 20 ml chromatography column (Bio-Rad, Hercules, CA, USA). After washing 3 column volumes with wash buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2020Quote: ... Cell suspensions were clarified by centrifugation (20 000 x g, 10 minutes, 4°C) and total soluble protein quantified58 using a kit (Bio-Rad Protein Assay Kit) and BSA as a standard.
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were denatured for 5 min at 95°C and gel was run using a 4-20% Mini-PROTEAN ® TGX precast protein gels (Bio-Rad, No. 4561094). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins extracts were boiled at 95°C and then separated onto Mini-PROTEAN ® TGX™ precast protein SDS-PAGE (4-15% gradient) gels (BIO-RAD, #4561083). Proteins were transferred onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were clarified for 5 min at 10,000 × g at +4□C and protein concentration was determined using DC Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). For immunoprecipitation ...
-
bioRxiv - Immunology 2020Quote: ... of protein were incubated in 1X Laemmli buffer with 0.1 M dithiothreitol at 65°C for 15 min and electrophoresed on 4-15% gradient TGX gels and transferred to PVDF membranes (Bio-Rad Laboratories, Mississauga, Canada). The membranes were blocked with Tris-buffered saline with 0.05% Tween 20 (TBST) ...
-
bioRxiv - Genetics 2020Quote: ... diluted samples were boiled for 5min at 95 °C and subsequently separated on a 4-15% Criterion™ TGX Stain-Free™ Protein Gel (Bio-Rad Laboratories) and ran in a Criterion™ Cell geltank (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... by tank blotting at 250mA for 90 min in a cold room (4 °C) in blotting buffer (catalog#1610734, Bio-Rad, Hercules, CA, USA). The membrane was blocked for 2 h in TBS-T (tris buffered saline supplemented with 0.1 % Tween ...
-
bioRxiv - Neuroscience 2023Quote: ... and denaturated by β-mercaptoethanol at 75°C before loading 50-60 µg protein onto 4-20% Mini-PROTEAN TGX Stain-FreeTM Protein Gels (Bio-Rad, Hercules, CA, USA) and electrophoresed at 120 V for 120 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and denaturated by β-mercaptoethanol at 75°C before loading 20-30 µg protein onto 4-20% Mini-PROTEAN TGX Stain-FreeTM Protein Gels (Bio-Rad, Hercules, CA, USA) and electrophoresed at 120 V for 120 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 40ug of each sample was denatured at 95°C for 5 minutes and loaded in 4–20% Mini-PROTEAN® TGX™ Precast protein gels (Bio-Rad; SA) with a gel lane including a Dual Xtra standard protein ladder (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Selected siRNAs were spotted onto a gridded MatTek dish (P35G-2-14-C-GRID) using a contact spotter (ChipWriter Pro-Bio-Rad Laboratories) resulting in a layout of 4 × 8 spots 40 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Aliquots of 50 μg protein in SDS-PAGE sample buffer containing 0.2 M dithiothreitol were heat-denatured for 5 min at 95 °C then electrophoresed on AnyKD midi criterion™ gels (Bio-Rad) in ProSieve™ EX running buffer (Lonza) ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... concentration of total aerobic GNB and of MDR-GNB were determined by plating serial dilutions (pure, 10−2, 10−4) of initial faeces or EA sample onto Drigalski agar (Bio-Rad) with or without 1mg/L cefotaxime ...
-
bioRxiv - Biophysics 2020Quote: ... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 29 sera collected from individuals 1 month after BA.5-bivalent-booster of Pfizer or Moderna vaccine ...
-
bioRxiv - Microbiology 2023Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 20 sera from individuals who were previously infected by SARS-CoV-2 vaccinated with 2-4 doses of parental mRNA vaccine ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... PAGE gels were run at 130V for ∼1h in Bis-Tris buffer (GeneScript) and then wet transferred to a 0.2 µm PVDF membrane (BioRad, activated in 100% methanol) at 100V for ∼1 h in 1X transfer buffer containing 20% methanol ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad, 4–15% Tris/Glycine) and then transferred onto 0.2 µm nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysates were clarified at 13,200 rpm for 15 min at 4°C prior to quantification by Lowry assay (Bio-Rad cat # 5000113 and cat # 5000114). Whole cell lysates were loaded into 4-20% Criterion TGX Precast 18 well gels (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mixtures were heated to 90°C for 10 min and slowly cooled to 40°C (0.1°C / second) using a Dyad PCR machine (Bio-Rad).
-
bioRxiv - Biochemistry 2022Quote: ... Samples were heated from 10 °C to 95 °C (10 s at each 0.5 °C step) using a CFX Connect qPCR (Bio-Rad). Melting temperatures were calculated with DSFWorld61 using model 1 in the “by sigmoid fitting” option ...