Labshake search
Citations for Bio-Rad :
651 - 700 of 10000+ citations for 6 Isoquinolinol 1 4 5 dimethoxy 2 5 6 6a 7 tetrahydro 1 2 10 trimethoxy 6 methyl 4H dibenzo de g quinolin 9 yl oxy phenyl methyl 1 2 3 4 tetrahydro 7 methoxy 2 methyl S R* R* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were electrophoresed in a Bio-Rad Criterion TM Vertical Electrophoresis Cell at 90-120V for 1-2 hours and then transferred to a PVDF Transfer Membrane (#88518, Bio-Rad, Hercules, CA, United States) using the Bio-Rad Trans-Blot Turbo Transfer System ...
-
bioRxiv - Plant Biology 2021Quote: ... the Agrobacterium-infiltrated leaves were visually inspected at 2-5 days post infiltration and/or the fluorescence of the infiltrated leaves were monitored at 1-2 d post infiltration under the Pro-Q Emerald 488 in the ChemiDoc™ Gel Imaging System (Bio-Rad, Hercules, CA, USA) as described previously (Yoon and Rikkerink 2020).
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were incubated for 2 h at room temperature in HRP conjugated IgG anti-rabbit secondary antibody (Bio-Rad 170-65-15, 1:3000) or Cy5 conjugated IgG anti-mouse secondary antibody (Jackson ImmunoResearch Laboratories Europe Ltd. ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were blocked in serum and then incubated in primary antibody for 2 hr at RT (CD-68: 1:500, Bio-Rad clone FA-11, MCA1957GA), and then processed for secondary and HRP reagent using a Vectastain ABC kit according to the manufacturer’s instructions (Rat IgG ...
-
bioRxiv - Immunology 2021Quote: ... They were incubated at the room temperature for 5-10 min and they were placed inside a 4-mm cuvette (Bio-Rad). The cuvettes were pulsed using the BTX electroporator (300 V ...
-
bioRxiv - Physiology 2021Quote: ... Protein aliquots were denatured in Laemmli sample buffer at 100°C for 5 min and then loaded (10– 15 μg protein per lane) on 4–20% Criterion TGX Stain-free gels (Bio-Rad) and run for 45 min at 200 V ...
-
bioRxiv - Neuroscience 2022Quote: ... at either 95°C for 5 minutes or at 70°C for 10 minutes and resolved in a 4-15% Precast Gels (Bio-Rad, 12-well ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were incubated at 95°C for 5 min and 10 μL of the sample was resolved on a 4%–15% Mini-PROTEAN® TGX Precast Gel (Biorad) and stained with Coomassie Blue.
-
bioRxiv - Biochemistry 2023Quote: ... The samples were incubated at 95°C for 5 min and 10 μL of the sample was resolved on a 4%–15% Mini-PROTEAN® TGX Precast Gel (Biorad) and stained with Coomassie blue dye.
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were denatured by 5 min incubation at 95°C before running them on a TGX 4–12% or 10% gel (Bio-Rad) and transferred onto nitrocellulose membrane for hybridization with specific antibodies.
-
bioRxiv - Molecular Biology 2019Quote: ... in TE (25 min) followed by de-staining in TE (5-10 min) and imaging on a ChemiDoc XRS+ instrument (BioRad). The fraction of nucleosomal DNA shifted was quantified using Image Lab 6.0.1 (BioRad ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were sonicated and heated at 95°C for 5 minutes before their separation on a 4-15% gradient SDS PAGE gel (Biorad, 4-15%). Proteins were transferred from gel to nitrocellulose membrane using semi-dry method ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins (5 μg) were separated on a 4–15 % polyacrylamide gradient gel (Bio-Rad) and then transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Physiology 2019Quote: ... and blocked for 24 hours at 4°C in 5% blotting-grade blocker (BioRad). Blots were incubated in primary OXPHOS antibody (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2023Quote: ... Primary antibody staining was performed overnight at 4&C using rabbit anti-mouse Iba-1 (1:500; Wako Chemical Cat #019-19741) and CD68 (1:200; Bio-Rad Cat #MCA1957) with secondary staining performed for 45 minutes RT using Alexa Flour 594 donkey anti-rabbit (1:400 ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were resolved on native acrylamide gels containing 0.5X TBE buffer and 7% acrylamide (made from a stock of 40% acrylamide with a ratio of 29:1 acrylamide:bisacrylamide; Bio-Rad). The running buffer for the gels was 1XTBE ...
-
bioRxiv - Bioengineering 2019Quote: Native PAGE gels were prepared as follows: a fresh solution comprising of polyacrylamide (19:1) at final concentrations from 7 to 13% (Biorad), 0.5x TBE buffer (45 mM Tris-borate ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments was separated on 20% denaturing acrylamide gel (5% crosslinker, 7 M urea, 1X TBE buffer) using Criterion™ cell apparatus (Bio-Rad) at 300 V for 40 to 60 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Immunology 2021Quote: ... Basically 300 ug of IVIG protein were subjected to isoelectric focusing (IPG) across pH gradients of 4-7 (Biorad, LifeSciences, Hercules, Ca, USA) or pH 6-11 (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were centrifuged for 2 min at 12,000 x g before being separated on 8–16% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad) at 160 V for 60 min ...
-
bioRxiv - Microbiology 2019Quote: ... YpdA and YpdAC14A proteins were pre-reduced with 10 mM DTT followed by DTT removal with Micro Biospin 6 columns (Biorad). For the biochemical activity assays of the specific BSSB reductase activity ...
-
bioRxiv - Cancer Biology 2022Quote: Proteins were resolved in 6-8-10 or 12% polyacrilammide gels and transferred to PVDF (Bio-Rad, Hercules, CA,USA) or nitrocellulose membranes (GE Heath Care ...
-
bioRxiv - Immunology 2020Quote: ... a total of 6 × 107 cells was incubated in staining buffer with mouse anti-pig CD4 alpha (clone MIL17, Bio-Rad AbD Serotec, Puchheim, Germany, 1:50) at 4°C for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... at 4° C with 100 V for 1 hour in 1 x Tris/Glycine Buffer (Bio-Rad, Cat#1610734) and 20% methanol (Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: The cDNA was diluted 1/5 with dH2O and 2.5 µL were used for qPCR analysis (10 µL total volume; BioRad, iTaq Universal SYBR Green Supermix ...
-
bioRxiv - Neuroscience 2022Quote: ... for 1 minute and then imaging every 10 seconds for 5 minutes on the ChemiDoc XRS+ machine (Bio-Rad). ImageLab (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Immunology 2021Quote: ... Quantitative PCR was performed in 20 μL reactions in triplicate containing 10 μL 2 × SsoFast EvaGreen Supermix (Bio-Rad,), 1 μL of primers (3 μM F and 3 μM R) ...
-
bioRxiv - Microbiology 2020Quote: ... and 30μg of total protein per sample was mixed with Laemmli buffer supplemented with 2-mercaptoethanol (10%) (Bio-rad) and boiled at 99°C for 10 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR reactions were conducted using 10 µL 2× SYBR-Green Universal Master Mix (Bio-Rad, Hercules, CA, USA), 2 µL of forward primer (9 mM) ...
-
bioRxiv - Plant Biology 2022Quote: ... Each RT-qPCR reaction (10 μl) included 2 × iTaq™ Universal SYBR®Green Supermix (Bio-Rad, CA, USA), 500 nM forward and reverse primers (Supplementary File 1C) ...
-
bioRxiv - Developmental Biology 2024Quote: ... centrifuged at 14,000rpm at RT for 2 minutes and separated on precast 10% SDS-PAGE gels (4561036, Bio-Rad) at 100V for 70 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µL of cDNA was added to 10 µL of Bio-Rad ddPCR Supermix for Probes (1863024; Bio-Rad), followed by the addition of 1 µL of TaqMan miR-146a-5p 20X primer mix (4427975 ...
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer (HN: 5% Blotting Grade Blocker, Bio-Rad cat ...
-
bioRxiv - Microbiology 2022Quote: ... a desalting step was performed using micro Bio-Spin™ 6 (BIO-RAD) with 500mM ammonium acetate ...
-
bioRxiv - Immunology 2021Quote: ... followed by desalting using Micro Bio-spin 6 Chromatography Columns (Biorad, 732-6200). Then ...
-
bioRxiv - Immunology 2022Quote: ... using Iodogen reaction and then purified by P-6 spin column (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using primers shown in Supplementary Table 6 and IQ SYBRGreen supermix (Bio-Rad). The relative standard curve method was used to calculate arbitrary gene expression using CFX-manager software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... bead supernatant was transferred to gel filtration column (Micro-Bio Spin 6, BioRad). Filtrate was added onto DNA Polymerase 1 (PolI ...
-
bioRxiv - Biochemistry 2021Quote: ... Excess MTS reagents were removed with Micro Bio-Spin 6 columns (Bio-Rad) equilibrated in crosslinking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were purified with Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were buffer-exchanged using Micro Bio-Spin 6 desalting column (Bio-Rad) into 200mM ammonium acetate (pH adjusted to 7.4 with ammonium hydroxide) ...