Labshake search
Citations for Bio-Rad :
651 - 700 of 5400 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 4× Laemmli sample loading buffer (BioRad) was added to the supernatant and the mixture was boiled for 5 mins at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or 4-20% gradient gels (BioRad). Coomassie blue was used to stain gels with recombinant proteins ...
-
bioRxiv - Genetics 2024Quote: ... 4×Laemmli Sample Buffer (Bio-Rad) was added to lysates and samples were denatured at 50°C for 15min (and not boiled to prevent the aggregation of the DMT1 transmembrane protein) ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...
-
bioRxiv - Neuroscience 2020Quote: ... One microgram of RNA was converted to cDNA using the iScriptTM cDNA synthesis kit (Bio-Rad). Primers for A1/A2 transcripts were ordered directly from Liddelow et al28 ...
-
bioRxiv - Microbiology 2021Quote: ... quantitative RT-PCR was performed using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and the CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RT-qPCR was performed using iTaq Universal One-Step RT-qPCR Kits (Bio-Rad, cat.# 1725150). RT-qPCR primers were designed using Primer359 and are listed in Supplementary Table 13 ...
-
bioRxiv - Immunology 2021Quote: ... Products were analyzed by agarose gel electrophoresis in a ChemiDoc XRS-Quantity One Image Analyzer (BioRad)
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using the iTaqUniversal SybrGreen one-step kit (BioRad, Hercules, Ca, USA) according to the manual protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... iTaq Universal SYBR Green One step RT-PCR kit (cat# 1725150) was purchased from Bio-Rad. Mature miR-146a (cat# YP00204688) ...
-
bioRxiv - Neuroscience 2024Quote: ... was used for signal detection and densitometric analyses were performed using the Quantity One software (Biorad).
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR reactions were performed using the iTaq Universal Sybr green One-step kit (Bio-Rad) with the following reaction mix per sample ...
-
bioRxiv - Microbiology 2024Quote: ... with visualization on a Personal Molecular Imager FX scanner and analysis with Quantity One software (BioRad).
-
bioRxiv - Microbiology 2023Quote: ... one-step RT-ddPCR (1-Step RT-ddPCR Advanced Kit for Probes, Bio-Rad, Hercules, CA) was used to determine absolute quantification of N and S vRNA copy numbers in culture supernatants and cell lysates using the OC43 ...
-
bioRxiv - Physiology 2024Quote: ... One μg of total RNA was reverse-transcribed as per the manufacturer’s instructions (VWR and BioRad). The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: The protein expression was assayed and densitometric analysis was performed using quantity one software (Bio-Rad) as reported previously (11) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... one microgram of isolated RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (BioRad). Using the DyNAmo HS SYBR green qPCR kit (F-410L ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fraction bound was determined by densitometry of raw data using Quantity One® (v4.6.7, Bio-Rad) and the following equation for specific bands and then normalized ...
-
bioRxiv - Neuroscience 2022Quote: ... A GS-800 calibrated densitometer with Quantity One 1-D Analysis Software 4.6 (Bio-Rad Laboratories) was used for quantitative analysis of protein levels ...
-
bioRxiv - Zoology 2022Quote: gRNA was quantified by RT-qPCR using the iTaq Universal probe one-step kit (Bio-Rad) with primers and probe targeting the DENV2 envelope [27] ...
-
bioRxiv - Plant Biology 2023Quote: ... One µg of RNA was reverse-transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad). Real-time quantitative PCR was performed in a final volume of 5 µl including 10% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometry analysis was performed using Bio-Rad Quantity One image analysis software (Bio-Rad, Hercules, CA).
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed on CFX97 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 10 µL of cells expressing One-Pot PURE proteins were mixed with Lammeli Buffer (Bio-Rad) and boiled at 95°C for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 mL of stacking gel solution (enough for one 1.5 mm Bio-Rad mini gel cast) was prepared by mixing together ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram of total RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (Bio-Rad). qPCR reactions were performed with the SYBR Green PCR Master Mix (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... 0.128mM 2-Mercaptoethanol (BioRad), and 1X Leukemia Inhibitory Factor (purified and gifted by Barbara Panning Lab at UCSF).
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad) as described elsewhere 72,73 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2% bis-AA (BioRad) as described elsewhere (Fischer et al. ...
-
bioRxiv - Genomics 2022Quote: ... 2% SDS (Bio-Rad) and 2 mg/mL proteinase K (New England Biolabs) ...