Labshake search
Citations for Bio-Rad :
6851 - 6900 of 9194 citations for Glutathione Fluorescent 384 Well Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were determined by DC Protein Assay kit (Bio-Rad; Hercules, CA, USA) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: 1µg of purified RNA was reverse transcribed using iScript cDNA synthesis Kit (BioRad, #1708891). For secondary structure sensitive reverse transcription reactions (Figure 2E and F) ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and cDNAs were synthesized with iScript™ cDNA synthesis kit (1708841, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2022Quote: It was performed using the kit iScriptTM cDNA synthesis (Bio-Rad, cat. no 1708890). 500 ng of RNA were mixed with 2 µl of 5X iScript Reaction Mix and 0.5 µl of the enzyme iScript Reverse transcriptase in a volume of 10 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cDNA synthesis was done by iScript™ cDNA Synthesis kit (Cat #1708891, BIO-RAD) in each condition ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was prepared with the help of iScript gDNA clear cDNA synthesis kit (Biorad). cDNA was added to iTaq Universal SYBR Green Supermix and gene specific primers ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). Clarified lysates (5 min × 5,000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... and reverse-transcribed into cDNAs using cDNA iScriptTM advanced cDNA synthesis kit (Bio-Rad). Duplex ddPCR reactions were performed by combining cDNA products with human IL-1α ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1000ng RNA was used for cDNA synthesis with the Iscript kit (Bio-Rad) as described previously (19).
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using the DC Protein Assay Kit II (#5000112, Bio-Rad). Proteins (20μg ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was estimated by using the Bradford assay kit (Bio-Rad). 30 µg of total cellular proteins from the individual samples were subjected to SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the bound proteins were detected with the ClarityTM Western ECL kit (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were determined using DC Protein Assay Kit (Bio-Rad; Hercules, CA, USA). Proteins were separated by SDS-PAGE and were blotted onto an Amersham™ Protran® nitrocellulose membrane (Merck KGaA ...
-
bioRxiv - Microbiology 2023Quote: ... following either random priming or gene specific primers by iScript cDNA synthesis kit (BioRad). 20 μL of cDNA reaction is diluted 5 times before the quantitative PCR reaction ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted and transcribed to cDNA with a reverse transcription kit (Bio-Rad). Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were assembled using the ddPCR Supermix for Probes (No dUTP) kit (BioRad). Each ddPCR reaction contained 1 µl cDNA and either Dbh and Tbp or Th and Tbp probes (250 nM each ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA quality was determined by a bioanalyzer (Biorad, RNA Stdsense kit, Hercules, CA, USA). The RNA was reverse transcribed to cDNA with a SuperScript IV VILO kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... MRNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Q-PCR was performed on a CFX-Connect Real Time PCR Detection System using SYBR Green Master Mix reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA was synthesized from RNA using an iScript cDNA Synthesis Kit (Bio-Rad). qPCR was run with PowerUP SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... The complementary DNA (cDNA) was prepared using iScript™ cDNA Synthesis Kit (Bio-rad) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of RNA was converted to cDNA using iScript cDNA synthesis kit (BioRad). For Taqman real-time PCR analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using the iScript Reverse Transcriptase Supermix kit (BioRad, Cat# 1708841) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was carried out using iScript RT Supermix (BioRad cDNA kit, cart#1708841) and iTaq Universal SYBY green Supermix kit (BioRad cat# 1725121 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was reverse-transcribed by using iScript TM cDNA synthesis Kit (Bio-Rad) in a volume of 20 μL ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708890). Quantitative real-time RT-PCR analysis was performed using SYBR Green (Invitrogen ...