Labshake search
Citations for Bio-Rad :
6601 - 6650 of 7983 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Biophysics 2024Quote: ... The membrane was blocked by dipping in 3% skimmed milk (Bio-Rad) in PBS containing 0.1% Tween 20 (Amresco ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...
-
bioRxiv - Neuroscience 2024Quote: ... Each fraction is run through a 3-15% gradient gel (BioRad 45610840) alongside full keratinocyte cell lysate (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and filtered 3 times through gel filtration biospin P30 (Bio-Rad France). The purified NAMPT was then transferred to NAMPT elisa wells for quantitation as described in experimental section ...
-
bioRxiv - Biophysics 2024Quote: ... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
bioRxiv - Plant Biology 2021Quote: ... Leaf disks were ground to a fine powder evenly with a grinding tool and 120 μl extraction buffer added (30 μl Laemmeli sample buffer 4x [Bio-Rad], 24 μl DTT 1 M, 66 μl dH2O). Tubes were vigorously vortexed for 90 seconds ...
-
bioRxiv - Pathology 2021Quote: ... CST #2118) in 5% bovine serum albumin (total protein antibodies) or 5% dry milk (phospho-specific antibodies) Tris buffered saline (Bio-Rad #1706435) with 0.1% Tween-20 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.5 µL of each forward and reverse primer (10 µM) and 5 µL of SsoADV Universal SYBR® Green Supermix (Bio-Rad) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed again with TBST buffer for 5 times X 5 min and developed using Clarity Western ECL substrate (Bio-Rad, 1004384863). Images were captured on a Luminescent Image Analyzer (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked with 5% non-fat milk (BioRad) in 1X PBS with 0.1% of Tween 20 (PBS-T ...
-
bioRxiv - Immunology 2021Quote: ... containing 5% Blotting-Grade Blocker (Bio-Rad, # 170-6404) for 1□h ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 µL 2X SSOAdvanced SYBR Green PCR mix (BioRad), and 10 µM each of primer ( total volume ...
-
bioRxiv - Cancer Biology 2021Quote: ... After blocking in 5% non-fat milk (Bio-Rad) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% dry milk (Bio-Rad), incubated with goat polyclonal anti-ACE2 (R&D Systems AF3437 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membrane was blocked in 5% blocking reagent (Biorad) dissolved in TBS-T rocking for > 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and supplemented with 5% 2-mercaptoethanol (Bio-Rad Laboratories) for 8 minutes at 100 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked using 5% non-fat milk (Biorad) in TBST (0.1% Tween-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... blots were incubated in 5% milk blocking buffer (BioRad) for 1 hour at 4°C before primary antibody overnight at 4°C (See Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μl of anti-Pk antibody (Bio-Rad, MCA1360)-bound Protein A conjugated magnetic beads were added to the reactions and rotated at 25 °C for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laemmli sample buffer (Bio-Rad #1610747, 5% 2-mercaptoethanol) was added to 20 µg protein and samples were boiled at 95°C for 5 minutes before being loaded onto a 10% SDS-polyacrylamide gel (Bio-Rad #4568034) ...
-
bioRxiv - Neuroscience 2022Quote: ... Membrane was blocked with 5% nonfat milk (Bio-Rad) in TBS-T for 2 hours at room temperature and incubated with primary antibodies overnight at 4°C (Extended Data Table 4).
-
bioRxiv - Molecular Biology 2020Quote: ... 5% methanol) using a trans-blot system (Bio-Rad). Blocking the PVDF membrane was performed by shaking in TBS-T (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... followed by blocking with 5 % skim milk (Bio-Rad) in TBST buffer (50 mM Tris/HCl ...
-
bioRxiv - Cancer Biology 2020Quote: ... After blocking with 5% fat free dry milk (Biorad) membranes were probed with primary antibodies listed in Table 1 overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and blocked in 5% blotting grade blocker (Bio-Rad). Membranes were incubated with primary antibodies overnight (FOXA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... membranes were blocked using 5% skimmed milk (Bio-Rad) in TBST (TBS buffer containing 0.5% Tween-20 ...