Labshake search
Citations for Bio-Rad :
601 - 650 of 4550 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Genetics 2020Quote: ... First strand cDNA was generated using iScript cDNA synthesis reagents (Bio-Rad, Hercules, USA) using a fixed amount of RNA input (250ng ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Synthesis of cDNA was accomplished using the iScriptTM cDNA Synthesis Kit (Bio-Rad®), and 1000 ng of RNA was used as the input for the cDNA synthesis of each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, California) and qRT-PCR reactions were run on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using oligo-dT primers and iScript cDNA synthesis kit (BioRad, 1708891). Reverse transcription-quantitative Polymerase Chain Reaction (RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA was retro-transcribed into cDNA with the iScript cDNA synthesis kit (Biorad). Expression of the Klf2 gene was quantified with RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA synthesis was performed using iScript gDNA Clear cDNA synthesis kit (Bio-Rad) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesised with the iScript cDNA Synthesis kit (#1708891, Bio-Rad Laboratories) according to the manufacturers’ instructions ...
-
bioRxiv - Genomics 2022Quote: ... and reverse transcribed to cDNA using iScript cDNA synthesis kit (Bio-Rad, Cat# 1708891). TaqMan gene expression assays HS00174286_m1 and HS01561006_m1 were used to quantify the expression of TNFSF8 and FKBP5 genes in each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and cDNAs were synthesized with iScript™ cDNA synthesis kit (1708841, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cDNA synthesis was done by iScript™ cDNA Synthesis kit (Cat #1708891, BIO-RAD) in each condition ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad; 1708891). GoTaq quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad; Hercules, CA, USA), according to the manufacturer’s protocol using 1 µg total RNA in 20-µL reactions.
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules CA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... MRNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Q-PCR was performed on a CFX-Connect Real Time PCR Detection System using SYBR Green Master Mix reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... The complementary DNA (cDNA) was prepared using iScript™ cDNA Synthesis Kit (Bio-rad) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of RNA was converted to cDNA using iScript cDNA synthesis kit (BioRad). For Taqman real-time PCR analysis ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Generation of cDNA was performed using the iScript cDNA synthesis kit (BioRad cat# 1708890), reverse transcribing 1 μg of RNA per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted RNA was used for cDNA synthesis using iScript cDNA Synthesis kit (BIO-RAD) in accordance with manufacturer’s instruction ...
-
bioRxiv - Pathology 2023Quote: ... and cDNA synthesized from 1μg RNA with iScript cDNA synthesis kits (Bio-Rad 1708891). Quantitative PCR was performed using iQ SYBR Green super mix (Bio-Rad ...
-
bioRxiv - Physiology 2023Quote: ... and converted to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). qPCR was performed on a Bio-Rad CFX96 qPCR Detection System using a reaction mix containing Bio-Rad 2x SYBR Green Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from total RNA with the iScript cDNA synthesis kit (Bio-Rad) and qPCR was carried out with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Bioengineering 2023Quote: ... and cDNA was synthesized using iScript™ cDNA Synthesis Kit (#1706691, BioRad, CA, USA). RT-qPCR was performed using iQ™ SYBR green Supermix (#1708582 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was converted to cDNA using iScript cDNA Synthesis Kit (Bio-Rad, Cat# 1708891) and qPCR was performed using SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized from 1µg total RNA using iScript cDNA synthesis (BioRad, cat# 1708891) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) and a ProFlex thermocycler (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... RNA was converted to cDNA using iScript cDNA Supermix (Bio-Rad, Hercules, CA, USA). Quantitative droplet digital PCR (ddPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg of RNA was converted to cDNA using iScript cDNA Synthesis kit (BioRad) according to manufacturer’s instructions and diluted 1:100 in water ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was synthesized from total RNA using the iScript cDNA Synthesis kit (Bio-Rad). Real-time PCR was performed with cDNA using the SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by cDNA synthesis using an iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Real-time qPCR was performed to determine the expression levels of phenotypic markers (Table S1) ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708890). Quantitative real-time RT-PCR analysis was performed using SYBR Green (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was prepared with the help of iScript gDNA clear cDNA synthesis kit (Biorad). cDNA was added to iTaq Universal SYBR Green Supermix and gene specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was synthesized using 1ug of total RNA using iScript cDNA synthesis Kit (Biorad) on Bio-Rad T100 thermocycler ...
-
bioRxiv - Pathology 2023Quote: ... RNA was transcribed into cDNA using the iScript cDNA synthesis kit (BioRad, Hercules, CA). The cDNA was used for RT-qPCR with qPCRBIO SyGreen Blue mix Hi-ROX (PCR Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcribed into cDNA using the iScript cDNA synthesis kit (1708891, Bio-Rad). QRT-PCR was used to assess the levels of transcripts with gene-specific primers (Table 1) ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... and converted to complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturers’ instructions ...