Labshake search
Citations for Bio-Rad :
6151 - 6200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... This was followed by transfer to a PVDF membrane (MDI) using a wet transfer system (Bio-Rad, USA). The blot was blocked with 5% BSA in 1×TBS-T solution at room temperature for 1 hour followed by incubation with respective primary antibody CD-63 (1:500 dilution) ...
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR was performed in triplicate with a PCR starter kit in CFX96 Real-Time System (Bio-Rad, USA). hsa-miR-16-5p was used as an internal control to normalize the gene expression ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were transferred to nitrocellulose membranes using a Mini Trans-Blot apparatus (Bio-Rad) at 200 mA for 55 min in Towbin transfer buffer containing 0.1% SDS ...
-
bioRxiv - Microbiology 2024Quote: ... a double PARAFILM (Sigma)-layer flow chamber was incubated at 4°C overnight with 25ng/μL Digoxigenin Antibody (Bio-Rad) that adsorbed onto the polystyrene-covered lower surface ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to a low-fluorescence PVDF membrane (Bio-Rad), and blocked for 1 hour in Intercept Blocking Buffer (Li-Cor) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using iScript reverse transcription supermix (Bio-Rad Laboratories) and used as a template for amplification cycles conducted on a Corbett Life Science Rotor-Gene® 6000 thermal cycler with SsoAdvanced universal SYBR green supermix (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2024Quote: ... We used 1µL of DNA as a template for qPCR (BioRad CFX system), testing 5 biological replicates/landrace/community type ...
-
bioRxiv - Microbiology 2024Quote: ... The dried glycolipid fraction was redissolved in 1 mL of CHCl3/CH3OH (19:1) and applied to a column of silica gel (BioRad) equilibrated in CHCl3 ...
-
bioRxiv - Immunology 2024Quote: ... The blot was washed three times using 1XTBS-T and developed using an ECL imager (Bio-Rad, USA) [22].
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...
-
bioRxiv - Immunology 2024Quote: qPCR was performed in triplicates on thermocycler CFX Opus 384 (Bio-Rad Laboratories) operated by CFX Maestro software (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... following manufacturer’s instructions and visualized on a Chemi-Doc MP (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... Gels were then stained with InstantBlue Coomassie (Expedion) and imaged using a ChemiDoc XRS imager (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... was packed in an Econo-Pac Chromatography Column (Bio-Rad). It was washed with 2 × 10 CV of Ni-NTA buffer ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were transferred onto Protran nitrocellulose membranes (Schleicher & Schuell) using a wet transfer apparatus (Biorad). Membranes were probed using polyclonal αSipA ...
-
bioRxiv - Microbiology 2024Quote: ... Blot pictures were analyzed using ImageLab software (BioRad, USA). The intensity of each band was normalized to the intensity of the 70kDa band from the ladder ...
-
bioRxiv - Immunology 2024Quote: ... were coupled to ∼12x106 non-magnetic microspheres (BioRad carboxylated beads) and then incubated with study participant plasma (spun down 10,000g for 10 mins and diluted at 1:100 in the assay dilution buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and the CFX Connect RealTime PCR Detection System (Bio-Rad). Two technical duplicates were used for each biological replicate ...
-
bioRxiv - Microbiology 2024Quote: ... and resolved on a Mini-PROTEAN TGX Precast gel (Bio-Rad), and stained with Coomassie brilliant blue ...
-
bioRxiv - Immunology 2024Quote: ... After transferring the proteins to 0.45 µM nitrocellulose membranes (Biorad, Hercules, CA, USA), these were incubated for 1 hour in BSA 5% in PBS-Tween20 0.05% and then overnight at 4ºC with primary antibodies at 1:1,000 dilution ...
-
bioRxiv - Immunology 2024Quote: ... 1.5 μL of TEMED (#1610800, Bio-rad) and 3 μL of 10 % (w/v ...
-
bioRxiv - Immunology 2024Quote: ... 40 % acrylamide (1170 µL, #1610140, Bio-rad) and 2 % bis-acrylamide solutions (594 µL ...
-
bioRxiv - Immunology 2024Quote: ... and GM-CSF (Bio-Rad Laboratories, Hercules, USA). IL-1β was evaluated using an IL-1 beta Human ELISA Kit (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... Protein transfer was made using a TurboTransfer (Biorad, Hercules, CA, USA) at 25V for 7 mins ...
-
bioRxiv - Immunology 2024Quote: ... and transferred onto a nitrocellulose membrane (Bio-Rad), which were blocked with 5% milk for 1 hour and subsequently incubated with anti-mouse caspase-1 (Adipogen ...
-
bioRxiv - Immunology 2024Quote: ... Equal amounts of protein were loaded into a 4-15% gradient gel (Bio-Rad) and transferred onto a nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... and BSA were transferred in 10 µL volumes onto NC membranes with a pore size of 0.2 μm (Bio-Rad). Following the transfer ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... RPMI 1640 medium (Bio-Rad, 11-100-1K, without sodium bicarbonate) was supplemented with 2 mM glutamine (Satorius ...
-
bioRxiv - Immunology 2024Quote: ... The quantification of protein content was conducted using the Bradford assay (Bio-Rad, 5000001). A total of 30 µg of protein was subjected to separation by SDS-PAGE and transferred to nitrocellulose membranes ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentration and viability were then determined with Trypan Blue stain and a T20 cell counter (Bio-Rad, Hercules, CA).
-
bioRxiv - Immunology 2024Quote: ... and the FAM FLICA poly caspase kit (Bio-Rad). Cells were fixed with the Foxp3/Transcription factor staining buffer kit (eBioscience) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using the iScript cDNA Synthesis Kit (BioRad) and qRT-PCR was performed using PCRBio SyGreen Blue Mix Lo-Rox (PCR Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... Phenotypic carbapenemase characterization was performed with the imipenem hydrolysis test (β-CARBA test, Bio-Rad), immunochromatography with the NG-test CARBA 5 (NG Biotech ...
-
bioRxiv - Microbiology 2024Quote: ... Droplets were generated using and the” QX200™ Droplet Generator” (Bio-Rad) and analyzed after PCR with the “QX600 Droplet Reader” (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... and washed extensively using a vacuum manifold and Poly-Prep columns (BioRad). Washing was initially with lysis buffer ...
-
bioRxiv - Microbiology 2024Quote: ... Gene expression was measured by amplifying cDNA using iTaq SYBR Green Supermix (Biorad) on a QuantStudio 3 (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... and analyzed after PCR with the “QX600 Droplet Reader” (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... followed by imaging with an ChemiDoc Imaging System (Biorad).
-
bioRxiv - Microbiology 2024Quote: ... as previously described (Werle-Lapostolle et al., 2004) or by droplet digital PCR using the “ddPCR Supermix for Probes (No dUTP)” (Bio-Rad) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... using a thermocycler (Biorad) and stored at -20°C until further use ...
-
bioRxiv - Microbiology 2024Quote: Proteins were transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad, Hercules, CA, USA) and then blocked with 5% (w/v ...
-
bioRxiv - Microbiology 2024Quote: ... Ten microliters of sample were run on an Any-Kd Mini-PROTEAN TGX Precast gel (Bio-Rad) and then transferred to a Mini-size PVDF membrane (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... ICP1 genome replication was measured with primers Zac68(CTGAATCGCCCTACCCGTAC)/69 (GTGAACCAACCTTTGTCGCC) using iQ SYBR Green Supermix (Bio-Rad) and the CFX Connect RealTime PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by real-time RT-PCR targeting highly conserved regions of the IAV matrix (M) (10) using iTaq Universal Probes One-Step Kit (Bio-Rad, 1725141, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended to OD 10 in 1X Laemmeli Buffer supplemented with 2-mercaptoethanol (10%) (Bio-Rad) and boiled at 99°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... at a 1:3000 dilution and a secondary goat α-rabbit-HRP antibody (Bio-Rad) at a 1:10000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... and then transferred to a Mini-size PVDF membrane (Bio-Rad) using a Trans-Blot Turbo system (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... and imaged using a Chemidoc XRS imaging system (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... 10 μg capped RNAs were next delivered to cells by electroporation using a Gene Pulser X cell 617BR 11218 (BioRad).