Labshake search
Citations for Bio-Rad :
551 - 600 of 1961 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Then, 3 mL of each culture were pelleted (11,000 rpm, 1 min) to perform total RNA extraction (using BioRad’s Aurum™ Total RNA Mini Kit). RNA concentration and purity were assessed using a nanodrop and all samples shown to have A260/A280 and A260/A230 ratios ≥ 2 ...
-
bioRxiv - Microbiology 2023Quote: ... 12 % SDS-PA gels were fixed with fixation solution (40 % ethanol, 10 % acetic acid) o/n and stained in Flamingo fluorescent protein dye (Bio-Rad) for up to 6 h and imaged with the ChemiDoc (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... Volumes containing 10 µg of protein were resolved using SDS-PAGE (NuPAGE 3-12% gels, Life Technologies or 10% acrylamide Tris-Glycine, Bio-Rad for desmin fibrillar aggregates) and transferred to a nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein samples were heated for 3 min at 95°C and loaded on a 12-well Mini-PROTEAN TGX Stain-Free Gel (Bio-Rad Laboratories, Inc, Hercules, CA, USA). SDS-PAGE followed by densiometric analysis using the software ImageJ32.
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% non-fat milk (Bio-Rad) was used as the blocking agent for primary antibodies detecting non-phosphorylated proteins and all horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam ...
-
What challenges remain in harmonizing cytomegalovirus viral load quantification across laboratories?bioRxiv - Microbiology 2024Quote: ... (iv) 5 duplicates from Bio-Rad’s Exact Diagnostics Verification Panel 1.4 mL (CMVP200 ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked in 5% milk (1706404, BioRad) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad)) for 1 hour at room temp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 5% Milk (BioRad) in 1XTBS-T and incubated overnight in primary antibodies diluted in 5% milk at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... blocked with 5% blocking protein (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 5 second interval (Bio-Rad Gene Pulser Xcell Electroporation Systems) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Physiology 2023Quote: ... 5 μl SYBR Green mastermix (iTaq, Biorad) and 4 μl cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked in 5% blocking buffer (Bio-Rad), blotted in primary and secondary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-FLAG M2 (F1804 ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing 5% of nonfat milk (BIO-RAD). TBS-T buffer was used for all the membrane washings ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked in 5% milk (Biorad) or 3% BSA (Sigma) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...