Labshake search
Citations for Bio-Rad :
551 - 600 of 6638 citations for 10 14 Cadinene 4 5 Diol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... were then activated with 100% methanol and total protein extracts were transferred for 14 min at 25 V using a Trans-Blot Turbo Transfer System (Bio-Rad). Membrane-bound proteins were visualized with Ponceau S (78376 ...
-
bioRxiv - Microbiology 2021Quote: ... Each sample (30 µg) was run on a 14% SDS-PAGE gel and transferred to a nitrocellulose membrane (Bio-Rad, CA). HTLV-1 Gag expression in cells and VLPs in the cell culture supernatant was detected using a mouse monoclonal antibody HTLV-1 p24 (6G9 ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 1× TBE buffer at 1.32 V/cm for 14 hr at room temperature with buffer circulation in a Sub-cell GT electrophoresis system (15 × 20 cm gel, Bio-Rad). The gel was stained with 1× TBE buffer containing 0.3 μg/ml of ethidium bromide and photographed ...
-
bioRxiv - Biophysics 2021Quote: ... β-galactosidase activity in plates was achieved as previously described 14 with absorbance readings measured on a Benchmark Plus Microplate Reader (Bio-Rad) at 570 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated by SDS-PAGE electrophoresis in 12% or 14% acrylamide gels, and transferred on nitrocellulose membranes (Amersham, 10600021) by semi-dry electrophoretic transfer (Bio-Rad). Accordingly with primary antibody datasheets ...
-
bioRxiv - Genetics 2023Quote: ... Reaction mixtures were resolved on a 14% urea-PAGE gel (AmericanBio, Inc.) and analyzed using a PharosFX molecular imager (Bio-Rad). Single-nucleotide extension products were quantified using Image Lab software ...
-
bioRxiv - Microbiology 2023Quote: ... in 1X TAE buffer at 14 °C on a Bio-Rad clamped homogeneous electric field apparatus (CHEF-DR III, Bio-Rad). 3 V/cm were used with 96 h switch time of 600 s at 120° ...
-
bioRxiv - Cell Biology 2023Quote: Samples were diluted in 5x loading buffer and ∼30 mg run out on a 6-14% SDS-PAGE gel as described before semi-dry Western blotting (BioRad TurboID). Ponceau stained images were taken ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Neuroscience 2023Quote: ... 10-20 μg of total protein lysate was loaded into a 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (Biorad, cat. no. 4561095). Gels were transferred into PVDF membranes and blocked for 1 hour at room temperature in 5% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... 10-20 µg of total protein lysate was loaded into a 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (Biorad, cat. no. 4561095). Gels were transferred into PVDF membranes and blocked for 1 hour at room temperature in 5% BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... were resolved on a 4-15% or 10% acrylamide gel and transferred onto a PVDF membrane (Invitrogen iBlot 2 or Bio-Rad Trans-Blot Turbo system). Membranes were blocked with 5% milk (standard protein detection ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 10 well 10% TBE-Urea Gel (Bio-Rad) and run for 40 minutes at 200 V ...
-
bioRxiv - Microbiology 2020Quote: ... 8.4 μL of PCR Probe water and 10 μL of the 2x commercial reaction mixture (SYBR® Green Master Mix, Bio-Rad. A LightCycler96® (Roche) device was used and PCR conditions applied were ...
-
bioRxiv - Neuroscience 2020Quote: ... 30 μg of protein was heated in a 70°C water bath for 10 min before loading into a 4 – 20% Criterion TGX precast Midi protein gel (Bio-Rad, Hercules, CA, USA; Cat# 5671094) for SDS-PAGE followed by wet transfer to a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... Selected siRNAs were spotted onto a gridded MatTek dish (P35G-2-14-C-GRID) using a contact spotter (ChipWriter Pro-Bio-Rad Laboratories) resulting in a layout of 4 × 8 spots 40 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples (14 μL) were loaded into lanes where indicated of an Any kD Mini-PROTEAN TGX 15-well gel (#4569036, Biorad, Hercules CA). Electrophoresis was carried out in native Tris-glycine buffer (25 mM Tris ...
-
bioRxiv - Microbiology 2022Quote: We finalized the IPATS-BLV reaction in a 22-μl reaction mixture containing 14 μl of 2× ddPCR Supermix for Probes (Bio-Rad, #1863023), 909 nM of primers except the RPP30 primers (DRB3*016:01-forward ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% (BioRad) and run for 1 hour at 150 volts ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 4× Laemmli sample loading buffer (BioRad) was added to the supernatant and the mixture was boiled for 5 mins at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or 4-20% gradient gels (BioRad). Coomassie blue was used to stain gels with recombinant proteins ...
-
bioRxiv - Genetics 2024Quote: ... 4×Laemmli Sample Buffer (Bio-Rad) was added to lysates and samples were denatured at 50°C for 15min (and not boiled to prevent the aggregation of the DMT1 transmembrane protein) ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Immunology 2021Quote: ... with 0.5 μl of b-mercaptoethanol per well and heated at 70°C for 10 minutes before separation on a polyacrylamide gel (Bio-Rad Mini-PROTEAN TGX Gel 4-15%) and transferred to a PVDF membrane ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dharmacon, Cambridge, UK) or siRNAs targeting MYC (D-003282-14 & D-003282-35, Dharmacon) using siLentFect transfection reagent (1703362, Biorad, Hercules, CA, USA) (see Table S4 for siRNA sequences) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...