Labshake search
Citations for Bio-Rad :
551 - 600 of 7089 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Microbiology 2024Quote: ... and transcript quantification (QuantStudio 3, Bio-Rad Laboratories Inc., Hercules, CA) were performed as previously described (29).
-
bioRxiv - Cell Biology 2024Quote: ... in a Mini-PROTEAN®3 System (Bio-Rad, Hercules, CA). After electrophoresis ...
-
bioRxiv - Immunology 2020Quote: ... EVs or S-Trim preparations were separated by SDS-PAGE on a 4−15% acrylamide gel (4−15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently transferred onto PVDF membrane ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were analyzed by SDS-PAGE (either 4-20% Tris-glycine or 4-12% Bis-tris pre-cast gel, Bio-rad Laboratories, Inc.) and transferred to nitrocellulose membranes (Bio-rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lysates were heated for 15 minutes at 50 °C before being loaded onto 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM Tris ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 9.5). Quantification of Western blot images (SFig. 1-4) was carried out using ChemiDoc™ XRS+ Image Lab™ Software (Bio-Rad Laboratories AB, Sweden); statistical analysis was performed with GraphPad Prism software (version 5.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... and protein standards were mixed with Laemmli buffer and loaded on 4-15% Criterion TGX Stain-Free protein gels in 1×□TGS running buffer (all from Bio-Rad, Marnes-la-Coquette, France) and transferred to a 0.20μm PVDF membrane with the Trans-Blot Turbo RTA Midi Transfer Kit (Bio-Rad ...
-
bioRxiv - Biophysics 2024Quote: ... the solution was heated and slowly cooled from 80°C to 4°C (ramp rate of -1°C per 5 s) in a standard thermocycler (Bio-Rad CFX96 Real-Time System) prior to each experiment.
-
bioRxiv - Molecular Biology 2024Quote: ... Sections were then incubated overnight at 4°C with antibody cocktail consisting of rat anti-F4/80 (1:100) (catalog #: MCA497; Bio-Rad Laboratories; Hercules, CA, USA), rabbit anti-vimentin (1:100) ...
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Microbiology 2022Quote: ... Resulting lipopolysaccharides were separated using gradient 4–20% sodium dodecyl sulfate□polyacrylamide gel (4–20% Mini□PROTEAN® TGX™ Precast Protein Gel, BioRad, Hercules, USA) electrophoresis (SDS□PAGE ...
-
bioRxiv - Neuroscience 2023Quote: 15-20 µg of protein were loaded onto 4-12% Bis-Tris gels (Novex, Cat. no: NP0336BOX) or 4-20% Tris-Glycine extended gels (BIO-RAD, Cat. no: 4561095) for separation and transferred to nitrocellulose or methanol activated PVDF membranes ...
-
bioRxiv - Cell Biology 2024Quote: ... SDS-PAGE was performed either with standard gels (10 – 12% acrylamide depending on protein size with a 4% acrylamide stacking gel) or 4-15% Mini-Protean TGX precast protein gels (Bio-Rad, Hercules, CA, USA) for CRY1 and Histone at constant 160 V ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Biophysics 2024Quote: ... The membrane was blocked by dipping in 3% skimmed milk (Bio-Rad) in PBS containing 0.1% Tween 20 (Amresco ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...