Labshake search
Citations for Bio-Rad :
551 - 600 of 5609 citations for 1 2 Bromoethoxy 3 5 dimethylbenzene 97+% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and incubated with goat anti-rabbit IgG-alkaline phosphatase-conjugate secondary antibody (Bio-Rad, 1:3000 dilution) for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... Non-specific binding sites were blocked at room temperature for 1 hour with 5% (w/v) Blotting-Grade milk (Bio-Rad Laboratories, CA, USA) in Tris-buffer saline (Boston Bio Products ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Biophysics 2024Quote: ... The membrane was blocked by dipping in 3% skimmed milk (Bio-Rad) in PBS containing 0.1% Tween 20 (Amresco ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were loaded on a 3-8% tris-acetate gel (Biorad 3450131) in Tricine running buffer (Biorad 1610790 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 μL of 10 % (w/v) ammonium persulfate (#1610700, Bio-rad) were added to 500 μL aliquots ...
-
bioRxiv - Neuroscience 2024Quote: ... Each fraction is run through a 3-15% gradient gel (BioRad 45610840) alongside full keratinocyte cell lysate (+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... and filtered 3 times through gel filtration biospin P30 (Bio-Rad France). The purified NAMPT was then transferred to NAMPT elisa wells for quantitation as described in experimental section ...
-
bioRxiv - Biophysics 2024Quote: ... and 3 μL of N,N,N°,N°-tetramethyl ethylenediamine (Bio-Rad) were added to initiate the acrylamide polymerization ...
-
bioRxiv - Biophysics 2021Quote: ... one aliquot of Amberlite XAD-2 (BioRad) was added and allowed to incubate for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 μL β-mercaptoethanol (Bio-Rad) were added to 30 μL of sample ...
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad, Cat#161–0142) as described elsewhere 48 ...
-
bioRxiv - Biophysics 2021Quote: ... 200 mg of BioBeads (SM-2, BioRad) were added and the sample incubated for another 3 h at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10% 2-Mercaptoethanol (Bio-Rad, #1610710) and were heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: Kallestad Hep-2 Complete Kit (Bio-rad) was used to detect ANA reactive fecal IgA following the kit instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Bio-Beads (SM-2 resin; Bio-Rad) were added to the lysis reaction and samples were incubated for 1 hour in a mini-shaker (PS-3D ...
-
bioRxiv - Plant Biology 2020Quote: ... freshly supplemented with 2-mercaptoethanol (Biorad #1610710), heated for 30 min at 37°C and loaded into a polyacrylamide gel (any kD™ precast protein gel ...
-
bioRxiv - Biophysics 2020Quote: ... +/- 2-Mercaptoethanol (βME) (Bio-Rad Cat# 1610710). NuPAGE© gels (4-12% - Thermo Fisher Scientific Cat# NP0321 ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Immunology 2021Quote: ... 100 mg of biobeads SM-2 (BioRad) were added to the resin containing the protein of interest and the peptidiscs and incubated O/N at 4 ° C ...
-
bioRxiv - Bioengineering 2023Quote: ... Bio-beads SM-2 Resin (Bio-Rad) were introduced to the purified nanocage samples at a ratio of 5 g per 25 mL ...
-
bioRxiv - Biochemistry 2023Quote: ... 1.5 mL of 2% Bis-Acrylamide (Biorad) and 1.1 mL of water ...
-
bioRxiv - Physiology 2023Quote: ... 2 µL of protein ladder (BIORAD 1610374) was used ...
-
bioRxiv - Biophysics 2024Quote: ... Bio-Beads SM-2 resin (Bio-Rad) was added into the mixture ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 666 µL 2% bis-Acrylamide (Biorad, 1610142) and 3.08 mL ddH2O ...
-
bioRxiv - Cell Biology 2023Quote: ... 583 µL 2% bis-Acrylamide (Biorad, 1610142) and 3.16 mL ddH2O ...
-
bioRxiv - Cell Biology 2023Quote: ... 604 µL 2% bis-Acrylamide (Biorad, 1610142) and 1.896 mL ddH2O ...