Labshake search
Citations for Bio-Rad :
5701 - 5750 of 7321 citations for 4S 6 8 difluoro 3 4 dihydro 2H 1 benzopyran 4 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was generated using 1 μg of template RNA (iScript RT Supermix, BioRad, 1708841). cDNA was diluted 1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesised from 1 µg RNA using an iScript kit (BioRad). DNA was diluted to 10 ng/µland 2 µl was used in each RT-qPCR reaction with 10 µl iTAQ Universal SYBR green supermix (BioRad ...
-
bioRxiv - Neuroscience 2020Quote: ... and a rabbit anti-vasoactive intestinal peptide (1:500, catalog: 9535-0204, Bio-Rad). The secondary antibodies used in a study were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... and primer sets (Supplementary Table 1) in a CFX96 Real-Time System (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... incubated with a secondary antibody (1:3000 HRP–linked Anti-Rabbit antibody Bio-Rad) and protein bands were visualized with SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermofisher Scientific #34580 ...
-
bioRxiv - Bioengineering 2020Quote: 1 mm-thick micropatterned separation gels were stored in 1X tris-glycine (Bio-Rad) and buffer-exchanged to lower conductivity sucrose-dextrose dielectrophoresis buffer (DEP buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific binding was blocked for 1 hr at RT with 5% BLOTTO (Bio-Rad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Physiology 2020Quote: ... mouse monoclonal anti-Apolipoprotein A1 (Apo-A1) (0650-0050, Bio-Rad Laboratories, 1:200). Membranes were washed 3 times with TBST and incubated with anti-mouse IgG secondary antibody (A16017 ...
-
bioRxiv - Cell Biology 2021Quote: ... and StarBright® B700 labeled goat anti-rabbit IgG (Bio-Rad, 12004161, 1:5000).
-
bioRxiv - Microbiology 2020Quote: ... The bead/lysate mixture was poured onto a 1 cm separation column (Bio-Rad), the resin was allowed to pack and was washed with Wash Buffer (25 mM Tris-HCl [pH 8.0] ...
-
bioRxiv - Microbiology 2020Quote: ... The bead/lysate mixture was poured onto a 1-cm separation column (Bio-Rad), the resin was allowed to pack ...
-
bioRxiv - Microbiology 2020Quote: ... pre-amplified Exo 1 treated cDNA with Sso Fast EvaGreen Supermix (Bio-Rad laboratories). Quality control for determining ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1, BioRad), and traces of phenol were removed by triple extraction with equal volumes of chloroform:isoamyl alcohol (24:1) ...
-
bioRxiv - Cell Biology 2021Quote: Purified RNA (1 μg) were reverse transcribed using the iScript Reverse Transcription Supermix (Biorad). Quantitative real-time PCR (Q-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404) at room temperature ...
-
bioRxiv - Biophysics 2021Quote: In the experiments performed in water 1 cm quartz cuvette (Bio-Rad Labs, USA) was filled with 300 µl of fibrinogen water solution (150 µg/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1:2000)] proteins were detected using ClarityTM Western ECL Substrate (Bio-Rad. #170-5060). All western blots were repeated at least 3 times ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated 1h with HRP-conjugated secondary antibodies at 1:5,000 (Bio-Rad). After 4 more washes ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 min before being exposed to film or using a ChemiDoc Imager (BioRad) or Amersham 680 imager (GE) ...
-
bioRxiv - Cell Biology 2022Quote: ... Band densitometry analysis was performed using Quantity One 1-D Analysis Software (Bio-Rad). To normalize across different gels and to encompass all 3 ages and genotypes ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were treated with anti-BrdU (Rat anti-BrdU, 1:500; MCA, 2060, BioRad) antibody solution followed by washes in PBS and secondary antibodies were applied ...
-
bioRxiv - Biochemistry 2022Quote: ... and sheep anti-TGN46 (TGOLN2) 1:200 for IF (Bio-Rad Cat# AHP500, RRID:AB_324049). Fluorescently labelled secondary antibodies were purchased from Thermo Fisher Scientific and used at 1:500 for IF ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 1:200 or a mouse IgG isotype control (BioRad, Cat.#1706516; RRID: AB_11125547) at 1:200 in 0.75% Saponin (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... fibrosis was identified with an anti-collagen antibody (Bio-Rad, Hercules, CA, 1:500) with an Alexa Fluor™ 488 secondary (Invitrogen ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... Dylight 488-conjugated donkey-anti-sheep/goat IgG (Bio-Rad, STAR88D488GA; IF 1:400), Cyanine Cy™2-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression analysis was performed by using SYBR Green 1 (Bio-Rad, USA, 1725121) and LightCycler480 Thermocycler (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, CA, USA) with the conditions of 2.5kV ...
-
bioRxiv - Microbiology 2021Quote: ... The 20 uL PCR mixture contained 1× iTaq Universal SYBR Green Supermix (BIO-RAD), 0.2 uM of each primer ...
-
bioRxiv - Neuroscience 2020Quote: ... The primary antibodies against CD68 (1:500, mouse-anti-rat, Bio-Rad/Serotec, MCA341R) and Iba1 (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... 1:3,000 and secondary antibody goat anti-mouse IgG StarBright Blue 700 (Bio-Rad) 1:2500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-mouse IgG pAb conjugated to horseradish peroxidase (1:10,000, 170-6516, Bio-Rad) or anti-rabbit IgG pAb conjugated alkaline phosphatase (1:10,000 ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was estimated by Quick Start Bradford 1 X Dye reagent (5000205, BioRad) using a microplate reader (EnVision Multilabel Plate Reader ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 1 ug RNA using iScript Supermix (Bio-Rad, Hercules, CA) per manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... before incubating simultaneously with Goat Anti-Mouse IgG StarBright Blue 700 (1:1000; BioRad) and Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2022Quote: ... per dish/well supplemented with 1% (v/v) β-mercaptoethanol (1610710, Bio-Rad, Germany). Fibroblasts were then scraped off the plates (32 702180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The products were separated on native 10% polyacrylamide gels (acrylamide: bisacrylamide 19:1, Biorad). The gels were then dried and exposed to storage phosphor screens (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 μL ddPCR reaction mixture contained 1× ddPCR master mix (Bio-Rad, USA), 0.9 μM primers ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% Tween-20 (TBS-T): Goat anti-mouse Starbright700 (1:10000, Bio-Rad,12004158), Goat anti-rabbit IRDye800 (1:10000 ...
-
bioRxiv - Genetics 2020Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad) using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Biochemistry 2021Quote: ... and monoclonal anti mouse secondary antibodies conjugated to horseradish peroxidase (1:5000, Bio-Rad). After incubation with ECL substrate (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... starting from 1 μ were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer ...
-
bioRxiv - Genetics 2020Quote: ... membranes were incubated with HRP-conjugated goat-anti-mouse IgG (1:2000; Bio-Rad) for 1 h at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad), using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Neuroscience 2021Quote: ... We immunopanned RGCs from retinal suspension using Thy1.2 antibody (CD90, 1:800, Bio-RAD) and 0.02% BSA (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 ml Luminol/enhancer solution (Clarity™ Western ECL, BIORAD, Les-Ulis, France) and observed using ChemiDoc (ChemiDoc™ Imaging Systems ...
-
bioRxiv - Biophysics 2020Quote: ... Secondary antibody was goat anti-mouse IgG horseradish peroxidase conjugate (1:5,000; Bio-Rad). Blots were developed using the Luminata Forte Western HRP substrate reagent (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... was used at 1:10,000 and developed with Clarity Western ECL Substrate (Bio-Rad). mRFP1 from phagolysosomes was identified by the increased gel migration compared to native mRFP1 (Katayama et al. ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesis was performed using 1 μg of total RNA (iScript, Bio-Rad). qPCR was performed with the following gene-specific primers ...