Labshake search
Citations for Bio-Rad :
5551 - 5600 of 7138 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... fibrosis was identified with an anti-collagen antibody (Bio-Rad, Hercules, CA, 1:500) with an Alexa Fluor™ 488 secondary (Invitrogen ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... Dylight 488-conjugated donkey-anti-sheep/goat IgG (Bio-Rad, STAR88D488GA; IF 1:400), Cyanine Cy™2-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... Gene expression analysis was performed by using SYBR Green 1 (Bio-Rad, USA, 1725121) and LightCycler480 Thermocycler (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, CA, USA) with the conditions of 2.5kV ...
-
bioRxiv - Microbiology 2021Quote: ... The 20 uL PCR mixture contained 1× iTaq Universal SYBR Green Supermix (BIO-RAD), 0.2 uM of each primer ...
-
bioRxiv - Neuroscience 2020Quote: ... The primary antibodies against CD68 (1:500, mouse-anti-rat, Bio-Rad/Serotec, MCA341R) and Iba1 (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... 1:3,000 and secondary antibody goat anti-mouse IgG StarBright Blue 700 (Bio-Rad) 1:2500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-mouse IgG pAb conjugated to horseradish peroxidase (1:10,000, 170-6516, Bio-Rad) or anti-rabbit IgG pAb conjugated alkaline phosphatase (1:10,000 ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was estimated by Quick Start Bradford 1 X Dye reagent (5000205, BioRad) using a microplate reader (EnVision Multilabel Plate Reader ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 1 ug RNA using iScript Supermix (Bio-Rad, Hercules, CA) per manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... before incubating simultaneously with Goat Anti-Mouse IgG StarBright Blue 700 (1:1000; BioRad) and Goat Anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2022Quote: ... per dish/well supplemented with 1% (v/v) β-mercaptoethanol (1610710, Bio-Rad, Germany). Fibroblasts were then scraped off the plates (32 702180 ...
-
bioRxiv - Physiology 2019Quote: ... 1 μg RNA was reverse transcribed using IScriptTM cDNA synthesis kit (Biorad, Hercules, CA). RT-PCR was performed with the ViiaTM 7 Real-Time PCR System (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplicons were visualized on 1% agarose gel on the Geldoc XR system (Bio-Rad).
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked for 1 hr using 5% non-fat dry milk (Bio-Rad) and incubated with primary antibody overnight at 4 °C ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1–7.5 µl of the supernatant were loaded on precast gels (Bio-Rad). Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381 ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were blocked for 1 h with 5% fat free milk powder (Bio-Rad) in TBS + 0.05% tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2019Quote: ... goat anti-mouse IgG (H+L)-HRP conjugate (1:5,000 dilution, Bio-Rad Laboratories). After three washes with TBS-T ...
-
bioRxiv - Microbiology 2019Quote: ... for 1h at 1 mA/cm2 using a wet transfer system (Bio-Rad Laboratories). Blots were blocked and proved with 1° antibody in 5% milk (vol/vol ...
-
bioRxiv - Cell Biology 2019Quote: Pellets of DLD-1 cells were lysed in 2x Laemmli Sample Buffer (Bio-Rad), boiled for 15 min at 980C ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 µg of RNA was reverse-transcribed using the IScript cDNA synthesis kit (BioRad) or Superscript IV RT (Invitrogen) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The products were separated on native 10% polyacrylamide gels (acrylamide: bisacrylamide 19:1, Biorad). The gels were then dried and exposed to storage phosphor screens (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... cells were washed once with cold PBS and lysed in 1× sample buffer (Biorad) containing DTT ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies used were goat anti-mouse IgG HRP conjugate (Bio-Rad; 1:2000) and goat anti-rabbit IgG HRP conjugate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 20 μL ddPCR reaction mixture contained 1× ddPCR master mix (Bio-Rad, USA), 0.9 μM primers ...
-
bioRxiv - Plant Biology 2019Quote: ... The plasmids were coated on gold microparticles (1 μm diameter, Bio-Rad, California, USA) and bombarded on about one week old sorghum seedlings according to the protocol of (Jose-Estanyol ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% Tween-20 (TBS-T): Goat anti-mouse Starbright700 (1:10000, Bio-Rad,12004158), Goat anti-rabbit IRDye800 (1:10000 ...
-
bioRxiv - Genetics 2020Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad) using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Biochemistry 2021Quote: ... and monoclonal anti mouse secondary antibodies conjugated to horseradish peroxidase (1:5000, Bio-Rad). After incubation with ECL substrate (BioRad ...
-
bioRxiv - Cancer Biology 2021Quote: ... starting from 1 μ were designed through Beacon Designer 2.0 Software (Bio-Rad Laboratories). CLUH primers sequences were TACATCATGGGCGACTACGC (forward primer ...
-
bioRxiv - Genetics 2020Quote: ... membranes were incubated with HRP-conjugated goat-anti-mouse IgG (1:2000; Bio-Rad) for 1 h at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... absorbance at 254 nm was measured and recorded (Econo UV monitor EM-1, Biorad), using the Gradient Profiler software (version 2.07) ...
-
bioRxiv - Neuroscience 2021Quote: ... We immunopanned RGCs from retinal suspension using Thy1.2 antibody (CD90, 1:800, Bio-RAD) and 0.02% BSA (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... and 1 ml Luminol/enhancer solution (Clarity™ Western ECL, BIORAD, Les-Ulis, France) and observed using ChemiDoc (ChemiDoc™ Imaging Systems ...
-
bioRxiv - Biophysics 2020Quote: ... Secondary antibody was goat anti-mouse IgG horseradish peroxidase conjugate (1:5,000; Bio-Rad). Blots were developed using the Luminata Forte Western HRP substrate reagent (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... was used at 1:10,000 and developed with Clarity Western ECL Substrate (Bio-Rad). mRFP1 from phagolysosomes was identified by the increased gel migration compared to native mRFP1 (Katayama et al. ...
-
bioRxiv - Immunology 2020Quote: ... and cDNA synthesis was performed using 1 μg of total RNA (iScript, Bio-Rad). qPCR was performed with the following gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μL qPCR mix contained 1× IQ™ SYBR Green Supermix (BIO-RAD), 0.25 μM of each primer and 1 μL of 1:10 diluted DNA from individual gradient fractions ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μg of RNA was reverse transcribed with iScript™ reverse transcription (Biorad, 1708841). Quantitative polymerase chain reaction was performed using Sso Advanced Universal SYBR Green Supermix (Bio-Rad 1725274 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Revelation was performed using corresponding antibody (Table 1) with ECL Clarity Max (Biorad, 1705062). Images were acquired with ChemiDoc camera (Biorad ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μg of total RNA was reverse-transcribed using iScript RT Supermix (Bio-Rad). A real-time PCR was run in triplicate using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... along with Rhodamine-conjugated ɑ-GAPDH human Fab fragment (1:1000, Bio-Rad, 12004168). The blots were imaged on the ChemiDoc MP system and quantified using Image Lab software (Bio-Rad).
-
bioRxiv - Biophysics 2022Quote: ... Samples (1 mg of protein per well) were loaded onto a protein gel (BioRad, 4-15% Criterion TGX Stain-Free Precast Gel) ...
-
bioRxiv - Immunology 2022Quote: ... Secondary antibodies: goat anti-rabbit HRP (BioRad 1706515 or Invitrogen 65-6120, 1:5,000), anti-mouse HRP (Santa Cruz sc-525409 ...
-
bioRxiv - Microbiology 2022Quote: ... either HRP-conjugated goat anti-rabbit or an anti-mouse antibody (1:5,000, BioRad). Antibodies were detected using the enhanced chemiluminescence system (Immobilon Forte Western HRP substrate ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal Ab (mAb)-anti-sialoadhesin (Bio-rad, Inc., Hercules, CA, USA; 1:250), goat pAb anti-integrin-α3 (Santa Cruz biotechnology ...