Labshake search
Citations for Bio-Rad :
501 - 550 of 1612 citations for IL 15RA&IL 15 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Protein were loaded on a 12% or 4-15% SDS–PAGE TGX gel (BioRad) and subsequently blotted on a polyvinylidenedifluoride membrane (BioRad) ...
-
bioRxiv - Immunology 2023Quote: ... 30 μg of protein were resolved by 4–15% gradient SDS-PAGE (Bio-Rad) and transferred to PVDF (polyvinylidenefluoride ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded onto a 15% TBE-Urea gel (MINI- Protean, Bio-rad, 4566053) and run at 150 V for 3 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 4–15% Mini-PROTEAN® TGX™ Precast Protein Gels (BioRad, 4561086) and run at 100 V for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were separated on precast 4-15% gradient polyacrylamide gels (Bio-Rad, Hercules, CA) and transferred to PVDF membranes (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lysates were resolved by a 4-15% CriterionTM TGXTM Precast Gels (BIO-RAD) SDS–PAGE electrophoresis ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total protein (30 μg/sample) was resolved on 4–15% polyacrylamide gels (Bio-Rad) and transferred to PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: About 15 µg of proteins were separated on SDS-PAGE gels (Bio-Rad 3450009) at a constant voltage of 200V for 12 min ...
-
bioRxiv - Cell Biology 2023Quote: ... P4 and final supernatant were separated on a 15% Criterion Tris-glycine gel (BioRad) followed by transfer to PVDF membrane as previously described (4) ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein were separated by electrophoresis on 4-15% TGX (Bio-Rad) stain-free gels at 150-230V and then transferred to nitrocellulose membranes at 0.2A for 80 minutes using the wet transfer method ...
-
bioRxiv - Neuroscience 2024Quote: ... and electrophoresed on a 4-15% precast polyacrylamide gel (Bio-Rad, Hercules, CA, USA) in 25 mM Tris buffer containing 192 mM glycine and 0.1% SDS ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were loaded onto 4-15% Mini protean tgx-stain-Free gels (Bio-Rad Laboratories Canada Ltd ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4–15% Mini-PROTEAN® TGX™ precast protein gels (BioRad, 4561083/4561086) (for the rest protein ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... each sample was loaded onto TGX precast (4% - 15%) polyacrylamide gels (Bio-rad, USA) alongside Precision Plus Protein Dual Color Standards ...
-
bioRxiv - Immunology 2019Quote: ... After quantifying the optimal virus-to-erythrocyte concentration (4HA units), serial two-fold dilutions of Fc, control IVIG (GammaGard, Baxter Healthcare) and polyclonal goat anti-influenza B (Biorad) were prepared ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Imaging was performed using either an Odyssey Fc imaging system (Li-Cor) (quantified using Image StudioTM software) or a Molecular ChemiDocTM Touch Imaging System (Bio-Rad) (quantified using Image Lab 6.0.1 software).
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of total protein were loaded onto 4 – 15% Tris-Glycine gels (BioRad). Following electrophoresis (200 V for ∼45 min) ...
-
bioRxiv - Cell Biology 2019Quote: ... Equal amounts of cell lysates were resolved by 4–15% precast polyacrylamide gels (Bio-Rad) and transferred to nitrocellulose membrane (0.45μm ...
-
bioRxiv - Cell Biology 2020Quote: Protein samples were run in Mini-PROTEAN® TGX 4-15% Precast protein gels (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were fractionated on 15% SDS-PAGE (76) and transferred to nitrocellulose membranes (Bio-Rad). Blots were blocked with 5% (w/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 30 µL of each was loaded into a Criterion TGX 4-15% gel (BioRad, Hercules ...
-
bioRxiv - Developmental Biology 2020Quote: ... Protein samples (10 μg) were separated on 4 % - 15 % Bis-tris gels (Bio-Rad Laboratories) and wet-transferred onto a PVDF membrane ...
-
bioRxiv - Pathology 2022Quote: ... Lysates were run on 4-15% Mini-PROTEAN TGX Precast Gels (Bio-Rad, CA, USA) and blotted on 0.2 μm Trans-Blot Turbo Midi Nitrocellulose membrane (BioRad CA ...
-
bioRxiv - Developmental Biology 2022Quote: ... and loaded on 4–15% Mini-PROTEAN®TGX™ precast protein gels (Biorad, 4561083). Proteins were separated by electrophoresis at 70V for 15 minutes followed by 100V for approximately 1 hour using 10x Tris/Glycine/SDS running buffer (BioRad ...
-
bioRxiv - Molecular Biology 2020Quote: Denatured samples were separated on 4-15% Mini-Protean TGX SDS-PAGE gels (Bio-rad). Protein was transferred to methanol-activated PVDF membranes (Bio-rad ...
-
bioRxiv - Biophysics 2019Quote: ... Protein ubiquitylation was analyzed by SDS-PAGE using 4-15% Mini-PROTEAN-TGX gels (BioRad) and immunoblotting using anti-MBP antibodies.
-
Differential turnover of Nup188 controls its levels at centrosomes and role in centriole duplicationbioRxiv - Cell Biology 2019Quote: ... 15-50 μg of protein was separated on a 4-20% gradient gel (Bio-Rad) and transferred onto 0.2 µm nitrocellulose (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... at 25 V for 15 min 1.3 A using the Transblot Turbo Transfer System (BioRad). Membranes were blocked in 5% bovine serum albumin (BSA)/ PBS-0.001% Tween 20 (PBS-T ...
-
bioRxiv - Genetics 2020Quote: ... 160 μg of protein was separated on 4-15% Mini-Protean TGX gels (BioRad, Inc.), and then transferred to nitrocellulose ...
-
bioRxiv - Neuroscience 2020Quote: Equal amounts of E11 brain homogenates were loaded onto 4-15% TGX precast gels (BioRad) and transferred to nitrocellulose membranes (or polyvinylidene difluoride for alpha-catenin detection) ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteic samples were loaded in each lane of a 4-15% precast polyacrylamide gel (BioRad) and ran in Mini-Protean at 200V in Tris/Glycine running buffer (BioRad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (10 μg) were separated on 4-15% SDS-PAGE gradient gels (Bio-Rad) and blotted on Protran 0.45 nitrocellulose membranes (GE Healthcare) ...
-
bioRxiv - Plant Biology 2020Quote: ... separated on 4-15% [v/v] SDS-PAGE stain-free protein gel (Bio-Rad Laboratories), and blotted on Trans-Blot® Turbo™ Mini PVDF Transfer Packs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein (between 15-30 μg) was loaded onto Mini-Protean TGXTM precast gels (10%; Biorad), and transferred onto a nitrocellulose membrane (0.45 μm ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were resolved on a 4-15% Mini-PROTEAN TGX gel (Bio-Rad, Hercules, CA) and visualized using ProSignal Pico ECL Reagent (Genesee Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... SDS-PAGE was performed on Bio-Rad Mini-PROTEAN TGX 4-15% gels (Bio-Rad). Separated protein was blotted on Amersham Protran 0.45 µm nitrocellulose membranes (Cytiva) ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were separated by SDS-PAGE on pre-cast 4–15% polyacrylamide gels (Bio-Rad) using a Bio-Rad Mini-PROTEAN gel system ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein samples were run on 4-15% Mini protean TGX stain-free gels (Bio-Rad) at 100V for 4h at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 20-40 ug was loaded onto 4-15% pre-cast gels (Bio-Rad 17000546) and run using the Bio-Rad Mini-PROTEAN Tetra Cell system ...
-
bioRxiv - Microbiology 2020Quote: ... Lysates (109 cells) were electrophoresed on a precast 4-15% polyacrylamide gradient gel (Bio-Rad). Western blotting was performed as described previously (52) ...
-
bioRxiv - Genomics 2020Quote: ... Protein lysates (20-30ug) were then used for running using 10-15% gradient gels (Biorad) for 1.5 hours at 100-110V followed by dry-transfer to PVDF membrane (Biorad dry transfer) ...