Labshake search
Citations for Bio-Rad :
501 - 550 of 5252 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% Tris-Glycine (BioRAD precast gradient gels 5671084) were used for protein separation ...
-
bioRxiv - Cancer Biology 2022Quote: ... After fixing in 4% paraformaldehyde (Bio-Rad Laboratories, Inc.) for 15 min at room temperature and staining with 10 ng/ml Hoechst 33342 ...
-
bioRxiv - Microbiology 2022Quote: ... 4–20% Mini-PROTEAN TGX Gels (Bio-Rad #4561093) were used for electrophoresis ...
-
bioRxiv - Biochemistry 2023Quote: ... or 4-20% Criterion TGX-stain free gels (BioRad) and using 7.5 % SDS-PAGE using 1x Tris/glycine-SDS buffer (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... resolved on a 4-20% SDS-PAGE gel (BioRad), and visualized using a Li-Cor Odyssey imager.
-
bioRxiv - Synthetic Biology 2023Quote: ... running on 4-20% SDS-PAGE gel (Bio-Rad and Coomassie blue staining (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... 4–20% (15 well) SDS-PAGE gels (Bio-Rad) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Developmental Biology 2024Quote: ... A precast 4 - 20 % gradient gel (Bio-Rad, 4561093) was loaded with 25 µL of each sample and 10 µL of Dendra2 protein and run for 30 min at 70 V and 60 min at 90 V ...
-
bioRxiv - Microbiology 2024Quote: ... Electroporation was performed in 4 mm cuvettes (Bio-Rad), utilizing GenePulser Xcell with PC and CE modules (Bio-Rad) ...
-
bioRxiv - Neuroscience 2024Quote: ... run on 4%-15% polyacrylamide gel (Bio-Rad, 4561084), and transferred to PVDF membranes ...
-
bioRxiv - Biochemistry 2024Quote: ... run on the same gel (4-20% TGX, BioRad).
-
bioRxiv - Genomics 2024Quote: ... and 4*Laemmli Sample Buffer (Catalog#1610741, BIO-RAD). Proteins were separated on 4–20% Mini-PROTEAN® TGX Stain-Free™ Protein Gels ...
-
bioRxiv - Microbiology 2024Quote: ... Extracts were loaded onto 4-15% acrylamide gels (Biorad), transferred to Immobilon-P membranes (Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were separated on Tris-glycine 4-15% (Biorad) and transferred to PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... 4–15% Mini-PROTEAN TGX precast gels (Bio-Rad) were used for electrophoresis except for Figure 5 ...
-
bioRxiv - Neuroscience 2024Quote: ... 4% acrylamide and 0.2% bis-acrylamide (Bio-Rad Laboratories). Aspirated samples were then inverted onto a 40 µl drop of polymerization mixture (monomer buffer with the addition of 0.2% ammonium persulfate and 0.2% tetramethylethylenediamine ...
-
bioRxiv - Biochemistry 2024Quote: ... and loaded onto 4–15% gradient gels (Bio-Rad). Transfer of proteins occurred on a nitrocellulose membrane and then blocked for 1 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... run on a 4-12 % TGX precast gel (Biorad), proteins transferred onto nitrocellulose membrane at 80 V for 90 min and detected by immunoblotting with the antibodies indicated.
-
bioRxiv - Physiology 2024Quote: ... 4-15% polyacrylamide gels were used (Bio-Rad, #5678084). Total protein per lane was detected with Bio-Rad Stain-Free® technology and used for normalization ...
-
bioRxiv - Cell Biology 2024Quote: ... an appropriate volume of 4 x Laemmli (Bio-rad) sample loading buffer was added to the sample (10-20 μg of protein) ...
-
bioRxiv - Cell Biology 2024Quote: ... on a 4-15% TGX precast SDS-PAGE (BioRad) gel and visualized using InstantBlue Coomassie Protein stain (Abcam) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lysates were run on 4–15% gradient gels (BioRad), transferred to a PVDF membrane (BioRad) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Immunology 2020Quote: ... EVs or S-Trim preparations were separated by SDS-PAGE on a 4−15% acrylamide gel (4−15% Mini-PROTEAN® TGX Stain-Free™ Gel, Bio-Rad) and subsequently transferred onto PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed in 4% paraformaldehyde for 2 h at 4 °C and embedded in PBS containing 3% low-melting point agarose (Bio-Rad, California, USA). The agarose gels containing the fixed organoids were processed in a standard automated tissue histology processor ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were analyzed by SDS-PAGE (either 4-20% Tris-glycine or 4-12% Bis-tris pre-cast gel, Bio-rad Laboratories, Inc.) and transferred to nitrocellulose membranes (Bio-rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and the lysates were heated for 15 minutes at 50 °C before being loaded onto 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM Tris ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...