Labshake search
Citations for Bio-Rad :
5201 - 5250 of 7302 citations for Superoxide Anion Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified sfGFP was measured using a Quick Start Bradford Kit (BioRad, Hercules, CA, USA) in biological triplicate and technical triplicate.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated by using the Aurum total RNA mini kit (Bio-Rad) and treated with DNase (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... using iScript™ Reverse Transcription supermix for RT-qPCR kit (BIO-RAD Laboratories, USA) following manufacturer’s instructions at PCR conditions (priming at 25°C for 5min ...
-
bioRxiv - Microbiology 2020Quote: ... The iScript cDNA synthesis kit was used for reverse transcription (Biorad, Hercules, CA, USA). iTaq FAST SYBR Green Supermix with ROX (Biorad ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription was carried out using iScript cDNA synthesis kit (170-8891, Bio-Rad) for mRNA targets and TaqMan Advanced miRNA cDNA synthesis kit (ThermoFischer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Synthesis of cDNA was accomplished using the iScriptTM cDNA Synthesis Kit (Bio-Rad®), and 1000 ng of RNA was used as the input for the cDNA synthesis of each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, California) and qRT-PCR reactions were run on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... the reactivity of the colonies was detected using the Opti-4CN Substrate Kit (BIORAD), according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and used for reverse transcription with the iScript™cDNA synthesis kit (Bio-rad, Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using oligo-dT primers and iScript cDNA synthesis kit (BioRad, 1708891). Reverse transcription-quantitative Polymerase Chain Reaction (RT-qPCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Chemiluminescence detection was performed using Immun-Star WesternC Kit (Bio-Rad, Hercules, CA, USA), and the net intensities of each signal were quantified using ChemiDoc Imaging Systems (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... Purified RNA was retro-transcribed into cDNA with the iScript cDNA synthesis kit (Biorad). Expression of the Klf2 gene was quantified with RT-qPCR ...
-
bioRxiv - Genomics 2022Quote: ... mRNA extraction was performed using the Aurum™ Total RNA Mini Kit (Bio-Rad) as per the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA synthesis was performed using iScript gDNA Clear cDNA synthesis kit (Bio-Rad) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Extracted proteins were further purified using the BioRad ReadyPrep 2-D Cleanup Kit (BioRad), approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... and the plasmid DNA was isolated using Quantum Prep®Plasmid Midiprep Kit (Biorad) according to the manufacturer’s’ instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cDNA was synthesised with the iScript cDNA Synthesis kit (#1708891, Bio-Rad Laboratories) according to the manufacturers’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2023Quote: ... Purified total RNA was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-rad). Real-time quantitative PCR analysis was performed on a CFX Connect Real-Time System (Bio-rad ...
-
bioRxiv - Genomics 2022Quote: ... and reverse transcribed to cDNA using iScript cDNA synthesis kit (Bio-Rad, Cat# 1708891). TaqMan gene expression assays HS00174286_m1 and HS01561006_m1 were used to quantify the expression of TNFSF8 and FKBP5 genes in each sample ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: 1µg of purified RNA was reverse transcribed using iScript cDNA synthesis Kit (BioRad, #1708891). For secondary structure sensitive reverse transcription reactions (Figure 2E and F) ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and cDNAs were synthesized with iScript™ cDNA synthesis kit (1708841, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2022Quote: It was performed using the kit iScriptTM cDNA synthesis (Bio-Rad, cat. no 1708890). 500 ng of RNA were mixed with 2 µl of 5X iScript Reaction Mix and 0.5 µl of the enzyme iScript Reverse transcriptase in a volume of 10 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cDNA synthesis was done by iScript™ cDNA Synthesis kit (Cat #1708891, BIO-RAD) in each condition ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transcribed into cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was prepared with the help of iScript gDNA clear cDNA synthesis kit (Biorad). cDNA was added to iTaq Universal SYBR Green Supermix and gene specific primers ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... and reverse-transcribed into cDNAs using cDNA iScriptTM advanced cDNA synthesis kit (Bio-Rad). Duplex ddPCR reactions were performed by combining cDNA products with human IL-1α ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1000ng RNA was used for cDNA synthesis with the Iscript kit (Bio-Rad) as described previously (19).
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...