Labshake search
Citations for Bio-Rad :
5051 - 5100 of 6469 citations for 4 Bromo 4' Butyl 1 1' Biphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Lysate aliquots with 16 µg protein were denatured in 1× Laemmli sample buffer (Bio-Rad, 1610747) for 5 min at 95°C ...
-
bioRxiv - Genetics 2020Quote: ... in 11 parallel transformations (1 mL each) on a Bio-Rad MicroPulser (Bio-Rad, #165-2100). The parallel transformations were combined and mixed with a total of 9.5 mL of recovery medium ...
-
bioRxiv - Biochemistry 2020Quote: ... The absorbance readings were collected at 260nm with a Econo UV Monitor (EM-1 220V, Biorad). After fractionation ...
-
bioRxiv - Neuroscience 2021Quote: ... or Goat Anti-Rabbit IgG (H L)-HRP Conjugate (1:1000; Bio-Rad; Catalog # 172-1019) in TBS-T for 1 hr at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7) for 30 min to 1 hr then assembled in a dot blot apparatus (BioRad). After washing with 100 μl TE buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µg of RNA was reverse transcribed to cDNA by iScript cDNA synthesis kit (BioRad #17088) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Biochemistry 2021Quote: ... the detergent was removed by adding 0.5 g mL-1 (w/v) Bio-Beads (Bio-Rad) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The assay medium was prepared by diluting 1 volume of alamarBlue dye reagent (BUF012A; Bio-Rad) in 9 volumes of growth medium ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691, Bio-Rad). Transcript levels were analysed from three biological replicates by real time quantitative PCR (qRT-PCR) ...
-
bioRxiv - Microbiology 2020Quote: ... loaded onto a lab-made 8% TBE gel (Acrylamide/Bis solution 37.5:1, Bio-rad, 1610148), run at 200V for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... The following secondary antibodies were used: goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Microbiology 2021Quote: ... coli strain S17-1 using a Gene Pulser Xcell™ (Bio-Rad, Hercules, CA, United States) with the conditions of 2.5kV ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 μg) was reverse transcribed using an iScript gDNA Clear cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed with SYBR green (SsoAdvanced ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-conjugated Goat Anti-Rabbit IgG (H+L) (1:1000, 170-6515, Bio-Rad, CA, USA) or Goat-anti-Mouse IgG (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... qPCRs were then performed with 1 μl of cDNA using Universal SYBR green Supermix (BIO-RAD). Primer sets used for real-time PCR analysis are qcopA forward (CAATACCCTGGTGGTCGATAAAAC ...
-
bioRxiv - Microbiology 2020Quote: ... and 1: 25000 diluted secondary HRP conjugated Goat anti-mouse IgG (H+L) (BioRad, Mississauga, Canada). The blot was developed using Clarity Western ECL substrate (BioRad ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA (1 mg) was reverse-transcribed using iScript select cDNA synthesis kit (Bio-Rad, USA) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... at 1:3000 dilution and with the ladder conjugate (Precision Protein StrepTactin-HRP Conjugate, Bio-Rad) at 1:5000 dilution ...
-
bioRxiv - Genetics 2022Quote: ... The membranes were blocked with 1x Tris buffered saline with 1% casein (Bio-Rad, Cat #: 1610782) for 1 hour at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... First-strand cDNA was generated from 1 μg total RNA using the iScript cDNA kit (BioRad) with a poly-T primer as described in the kit’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled samples were diluted 1:1000 and subsequently used as templates for IQ SYBR (Bio-Rad) qPCR reactions ...
-
bioRxiv - Genomics 2022Quote: 1 µg of total RNA was reverse transcribed using iScript reverse transcription supermix (Biorad, Solna, Sweden). RT-qPCR was performed using a LightCycler 96 and the SYBR green master mix (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative RT-PCR was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystem) ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed and incubated with mouse anti-His (Bio-Rad MCA-1396; 1:1000) followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse secondary antibody (MerckMillipore AP124P ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA (1 µg) was reverse-transcribed using the iScript™ Reverse Transcription Supermix (Bio-Rad) as recommended by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... Electroporation was performed using a cuvette with a width of 1 mm and an electroporator (Biorad) with the settings ...
-
bioRxiv - Biophysics 2020Quote: ... Nanodisc reconstitution was achieved by incubation with 0.5 - 1 mL Bio-Beads SM-2 (Bio-Rad) for 16 hours at 4°C under constant rotation ...
-
bioRxiv - Neuroscience 2021Quote: ... at 100 V for 1 h at room temperature using Mini Trans-Blot Cell system (Biorad). Fast Green staining was used to detect the whole protein content on the membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... and 72 for 1 minute) and 72 °C for 10 minutes in a thermocycler (Bio-Rad). Amplified products were separated on 1.0% agarose gel electrophoresis (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... they were detected with goat anti-rabbit-HRP antibody (Bio-Rad catalog #170-6515; 1:10,000) diluted in TBST with 2% milk ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 412 nm (ε=13.6 mM−1cm−1) in a microplate reader (iMARK™, Bio-Rad). The results were normalized to cell proliferation.
-
bioRxiv - Biochemistry 2021Quote: ... cDNA was synthesized from 1 ug of RNA using iScript cDNA Synthesis Kit from Bio-Rad. PCR reaction was carried out using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: ... Total RNA (1 μg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and 1% Triton X-100) and resuspended in 30 µl of SDS sample buffer (Bio-Rad) and boiled for 10 minutes ...
-
bioRxiv - Genetics 2022Quote: ... 1 ug of RNA was reverse-transcribed using iScript RT Supermix (Bio-Rad 1708841, Hercules, CA). qPCR was performed using SsoAdvanced SYBR Green Super Mix (Bio-Rad 1725270 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were synthesized from 1 μg of RNA using iScript cDNA synthesis kit (Bio-rad, #1708891). 25 ng of total cDNA was used for qPCR with iTaq ™ Universal SYBR® Green Supermix (Biorad ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was prepared from 1 μg of total RNA with the iScript cDNA Synthesis Kit (Biorad), diluted 10 times and 1 μl was used in 5-μl PCR reaction on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 µg of total RNA was transcribed with the iScript Select cDNA Synthesis kit (Bio-Rad) using the random primers and oligo(dTs ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was measured using the Quick Start Bradford Protein Assay Kit 1 (Bio-Rad 5000201) in a Tecan Infinite F200 PRO spectrophotometer ...
-
bioRxiv - Microbiology 2022Quote: ... a 1:20,000 dilution of HRP-conjugated goat anti-rabbit secondary antibody (Bio-Rad, Hercules, CA), was incubated with the membranes at room temperature for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 µg) was subjected to reverse transcription using Iscript reverse transcription supermix (Bio-Rad). cDNA levels were assayed by real-time PCR using iTaq universal SYBR green supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... A total of 1 µg of RNA was reverse-transcribed using iScript Reverse Transcription Supermix (Biorad) and qPCR (45 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed in monomer solution (1 x PBS, 2 M NaCl, 2.5% acrylamide (Bio-Rad), 0.15% Methylenbisacrylamide (Santa Cruz) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of each RNA was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad Hercules) and subjected to RT-qPCR reaction using the TaqMan Fast Advanced Master mix (Applied Biosystems ...