Labshake search
Citations for Bio-Rad :
451 - 500 of 4753 citations for 8 9 Didehydro 3'N demethyl 9 deoxo 4'' 6 12 trideoxy 6 9 epoxy 3'N ethylerythromycin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and resolved on 4-12% Bis-Tris XT Precast 26-well gels (Bio-Rad). Proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were separate by PAGE on a 4–12% Bis-Tris polyacrylamide gel (Biorad 3450125), transferred onto nitrocellulose using the Trans-blot Turbo system (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... and analyzed by SDS-PAGE (4-12% Bis-Tris gel, Bio-Rad Laboratories, Inc). Non-reducing gels were incubated in 10 mM DTT for 5 min at room temperature prior to transfer to nitrocellulose membranes ...
-
bioRxiv - Molecular Biology 2019Quote: Proteins were separated on 4-12% Criterion XT Bis-Tris gels (Bio-Rad, #3450124) in NuPAGE MOPS running buffer (NP0001-02 Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were separated on 4-12% Criterion XT Bis-Tris gels (Bio-Rad, #3450124) in NuPAGE MOPS running buffer (NP0001-02 Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were separated on a 4-12% Mini Protean TGX gel (BioRad, Hercules, CA) in a Tris-glycin migration buffer (0.25 M Tris ...
-
bioRxiv - Cell Biology 2022Quote: ... The IP-RNA complexes were loaded on a 4–12% Bis-Tris (Bio-Rad) gel ...
-
bioRxiv - Neuroscience 2023Quote: ... resolved in a 4–12% SDS-PAGE gel (CriterionTM TGXTM, Bio-Rad Laboratories, Inc.) and transferred to a nitrocellulose membrane (Immobilon®-P ...
-
bioRxiv - Neuroscience 2023Quote: Protein samples were resolved by electrophoresis on 4-12% Bis-Tris gels (Bio-Rad) and were transferred to polyvinylidene difluoride membranes using the iBlot system (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... Forty μg of protein was electrophoresed on a 4-12% polyacrylamide gel (Bio-Rad) and transferred to nitrocellulose membranes (Amersham Biosciences ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein were loaded on a 12% or 4-15% SDS–PAGE TGX gel (BioRad) and subsequently blotted on a polyvinylidenedifluoride membrane (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... Equal amounts of protein were loaded onto a 4-12% Bis-Tris gel (BioRad) and separated by SDS-PAGE ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Biochemistry 2021Quote: ... and analyzed by Image Lab software (Bio-Rad, SOFT-LIT-170-9690-ILSPC-V-6-1). To measure the +1-frameshifting efficiency ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Biochemistry 2022Quote: All analytical gels were performed in 20% polyacrylamide gels (acrylamide:bisacrylamide 19:1) using 8×12 cm plates in a mini-PROTEAN system (BioRad). Acrylamide solution was prepared in 1X TBE buffer (89 mM Tris ...
-
bioRxiv - Microbiology 2022Quote: ... before separation by SDS PAGE using commercial gels (NuPAGE Novex 4-12% Bis-Tris gels (Thermo-Fisher-Scientific) or Mini-PROTEAN TGX 4-20% gels (Bio-Rad)) and transfer to 0.2 µm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Physiology 2020Quote: Electrophoresis was performed using a BioRad Mini-PROTEAN cell with 4-12% or 4-15% precast TGX gels (BioRad, Hercules, CA) in TGS running buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 3 mL of acrylamide/bis solutions (40%, Bio-Rad Laboratories, CA, USA), 1 mL of 10X tris-borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal amounts of proteins were mixed !3-mercaptoethanol-supplemented Laemmli buffer (BioRad), heated to 95°C for 5 min before being separated by SDS-PAGE with Criterion Precast Gels (4 –15% Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 trans-blot papers (Bio-Dot SF Filter Paper, Bio-Rad, #1620161) and one cellulose acetate membrane (Cellulose Acetate Membrane Filters ...
-
bioRxiv - Neuroscience 2021Quote: ... All Blue Prestained Protein Standards (1-3 µl; BioRad Laboratories, Hercules, CA) were used to identify band molecular weights ...
-
bioRxiv - Bioengineering 2022Quote: ... along with 3 μL of Precision Plus protein ladder (Bio-Rad #1610374), and gels were run at 125 V for 1.25 hours in Tris-Glycine running buffer (ThermoFisher #LC2675).
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed 3 times with 0.1% Tween-20 (Bio-Rad,1706531) TBS (TBTS-T ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and anti-F4/80 FITC (3:100, Bio-Rad Laboratories, Temse, Belgium). The single cells were washed with 1XPBS+1%FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed again 3 times before revelation by electrochemoluminescence (Bio-Rad) using the Chemi-doc XRS+ (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... After 3 washes with 0.05% Tween 20 (catalog number 1706531, Bio-Rad) in PBS (TPBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... to 3 mL for buffer exchange with an Econo10 DG column (Biorad) equilibrated in buffer A and eluted with 4 mL of the same buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a Mini PREOTEAN 3 cell (525BR058974; Bio-Rad, Hercules, CA, USA) and PowerPac™ Power Supply (043BR09142 ...
-
bioRxiv - Molecular Biology 2020Quote: The DNA was denatured using 0.5 M NaOH and 1.5 M NaCl and equal amounts were loaded onto a Hybond N + nitrocellulose membrane (GE Biosciences) using the Bio-Dot apparatus (Bio-Rad). Membranes were washed once with denaturing buffer and wash buffer (3× SSC) ...