Labshake search
Citations for Bio Basic :
1 - 50 of 75 citations for Rat N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: Cell lysate protein concentration was determined using a Micro BCA Protein Assay kit (Bio Basic). Unless specified ...
-
bioRxiv - Biophysics 2021Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility ...
-
bioRxiv - Biophysics 2022Quote: The gene encoding 419-residue SARS-CoV-2 N protein was purchased from a local company (Bio Basic Asia Pacific Pte Ltd), which was cloned into an expression vector pET-28a with a TEV protease cleavage site between N protein and N-terminal 6xHis-SUMO tag used to enhance the solubility (10) ...
-
bioRxiv - Cell Biology 2021Quote: ... and N-acetyl-L-cysteine (NAC) (Bio Basic) were used as anti-oxidants ...
-
bioRxiv - Bioengineering 2019Quote: ... Loading volumes of 10-15 μg of protein per well were calculated using a MicroBCA Protein Assay Kit (Bio Basic, SK3061) according to the manufacturer’s specification ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids (pcDNA3.1) encoding codon-optimised N genes at KpnI-BamHI sites referred to as pN were purchased from Bio Basic Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... was assembled from two synthetic fragments as follows: the N terminal FEN domain of Taq polymerase (with an Asp141Lys mutation (Bio Basic Inc, Canada)) flanked by an EcoRI site and ribosomal binding site (GAATTCTAAAAAGGAGGAAAACAT ...
-
bioRxiv - Biophysics 2019Quote: ... Protein quantification was done by Bradford method (Bio Basic Inc. USA) using Bovine Serum Albumin (BSA ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein production was then induced by the addition of 1 mM IPTG (Bio Basic) and incubation at 16°C overnight with agitation ...
-
bioRxiv - Biochemistry 2022Quote: Miniprep kit (Bio Basic, cat. no. BS614)
-
bioRxiv - Cancer Biology 2020Quote: ... HP Plasmid Midiprep Kits (Bio Basic Inc, Canada). was used to isolate the plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated using the RNeasy Kit (Bio Basic, BS1361) and reverse transcribed using the All-in-One cDNA Synthesis Kit (Bimake ...
-
bioRxiv - Biochemistry 2021Quote: ... coli using an EZ-10 total RNA purification kit (Bio Basic) and the integrity/purity confirmed using formaldehyde agarose gel electrophoresis and A260/A280 ratio (Biodrop) ...
-
bioRxiv - Immunology 2020Quote: EZ-10 Spin Column RNA Cleanup &Concentration Kit (Bio Basic Inc.);
-
bioRxiv - Systems Biology 2023Quote: EZ-10 Total RNA Mini-Prep Isolation kit (Bio Basic, Canada) was used according to the kit’s instructions to extract total RNA from the heart samples ...
-
bioRxiv - Cell Biology 2022Quote: ... then purified using DNA maxi-prep kit (Bio Basic; 9K-006-0023). mRNA was generated from plasmids using mMESSAGE mMACHINE™SP6 transcription kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
bioRxiv - Biochemistry 2024Quote: ... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
bioRxiv - Immunology 2021Quote: ... and EZ-10 DNAaway RNA Mini-Preps kit (Bio Basic Inc., Markham, ON). Cells were homogenized using glass beads in 1ml TRIzol Reagent and incubated on ice for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... and RNA was extracted using an RNA isolation kit (Bio Basic; Cat#BS82314). ProtoScript II reverse transcriptase (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... and EZ-10 DNAaway RNA extraction mini-prep kit (Bio Basic, Ontario, Canada) following manufacturer’s instructions ...
-
TIR signaling promotes the interactions between EDS1/PAD4 and ADR1-L1 and oligomerization of ADR1-L1bioRxiv - Plant Biology 2021Quote: ... and RNA was extracted using an RNA isolation kit (Bio Basic; Cat#BS82314). ProtoScript II reverse transcriptase (NEB ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was isolated using a genomic DNA extraction kit (Bio Basic Inc). Next-generation whole genome sequencing was performed by the Donnelly Sequencing Center ...
-
bioRxiv - Molecular Biology 2020Quote: The Bio Basic dual extraction kit was purchased from Bio Basic (BS88203, Toronto, Canada). This extraction kit uses a column technique to isolate DNA and RNA from samples ...
-
bioRxiv - Immunology 2021Quote: RNA from SFs was extracted using either EZ-10 RNA Mini-Preps Kit (Bio Basic, USA) or RNeasy Micro Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Amplified and digested DNA fragments were purified using the Gel Extraction Minipreps kit from Bio Basic. For all kits ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmids were extracted using a Miniprep kit according to the manufacturer’s recommendations (Bio Basic Inc.) and then transformed into E ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA was extracted using the EZ-10 Spin Column Plasmid DNA Minipreps Kit (Bio Basic) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted using the Rapid Plant RNA Isolation Kit (Bio Basic, Markham ON, Canada). RNA quality was confirmed by gel electrophoresis ...
-
bioRxiv - Genetics 2020Quote: ... The PCR product was purified using EZ-10 Spin Column PCR Products Purification Kit (BS664, Bio Basic) and eluted in 30 µl sterile water prior to sequencing.
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using 5X All-in-One RT Master Mix Kit (Bio Basic cat# HRT025-10). Real-time quantitative PCR was performed using Green-2-Go qPCR Master Mix (Bio Basic cat# QPCR004-S ...
-
bioRxiv - Molecular Biology 2020Quote: Plasmid DNA was prepared using either the EZ-10 Spin Column Plasmid DNA Miniprep Kit (Bio Basic) or the QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified using either the EZ-10 Spin Column PCR Products Purification Kit (Bio Basic) or the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted using the EZ-10 Spin Column Plant RNA Mini-Preps Kit (Bio Basic, Canada) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: RNA from cerebellum tissue was isolated using EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic, Canada) according to the manufacturers’ protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA was isolated from each sample using the EZ spin column genomic DNA kit (Bio Basic) and eluted with 30 μL of ultrapure water (Milli-Q) ...
-
bioRxiv - Microbiology 2023Quote: ... the resulting products were purified using the EZ-10 Spin Column PCR Products Purification Kit (Bio Basic) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... total RNAs were extracted with the EZ-10 DNAaway RNA Mini-Preps kit (Bio Basic, cat# BS88136) as recommended ...
-
bioRxiv - Biophysics 2021Quote: ... to remove the mutant Gsα sequence and purified via electrophoresis and gel extraction kit (Bio Basic, Markham, Canada). The resulted plasmid backbone and DNA fragment were fused using the pEasy assembly kit from TransGen Biotech following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Xela VS2 and EPC cells using the EZ-10 Spin Column Total RNA Minipreps Super Kit (Bio Basic) according to the manufacturer’s specifications with modifications to include an on-column DNase I digestion as described previously by our group (Bui-Marinos et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... whose DNA was extracted using the EZ-10 96-well Plate Animal Genomic DNA® kit (Bio Basic). In brief ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... ‘Hit’ colonies were grown overnight in LB-AMP medium and purified using a miniprep kit (Bio Basic, BS614). The insert was fully sequenced at the Cornell Biotechnology Resource Center Genomics facility and Microsynth AG (Switzerland).
-
bioRxiv - Biochemistry 2023Quote: ... PCR reactions were purified by EZ-10 Spin Column DNA PCR Purification Kit (Bio Basic Inc. #BS664-120712) with elution by 30 µL of ultrapure water instead of 50 µL elution buffer.
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated with All-in-One DNA/RNA Mini-Preps Kit according to the manufacturer’s protocol (Bio Basic) and reverse transcribed using either a QuantiTect Revese Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were lysed and RNA was extracted using EZ-10 DNAaway RNA Mini-Prep Kit (Bio Basic inc). cDNA was synthesized using Superscript IV (Thermo Fischer ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA extraction was performed using the EZ-10 Spin Column Plant RNA Miniprep Kit (Bio Basic Inc., Toronto, Canada). RNAs were reverse transcribed into cDNAs by OneScript Reverse Transcriptase (Applied Biological Materials Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from tissue culture cells using either the EZ-10 spin column kit (Bio Basic, Markham, Canada) or the MagMAX mirVana Total RNA Isolation Kit (Thermo Fisher Scientific A27828 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Its genomic DNA was extracted from an axenic 50 ml of culture using the Molecular Biology Kit (Bio Basic) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was isolated from lysed cells using an EZ-10 spin column total RNA minipreps super kit (Bio Basic) following manufacture instructions ...
-
bioRxiv - Immunology 2022Quote: ... DNA was purified using EZ-10 Spin Column Animal Genomic DNA Mini-Prep Kit (Bio Basic, Inc., Markham, Ontario, CA). Spirochete burdens were quantified based on the amplification of recA from B ...