Labshake search
Citations for GeneCopoeia :
51 - 100 of 132 citations for Recombinant Human Programmed Cell Death 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: Overexpression of human MDK was performed using the ORF lentiviral expression vector pReceiver-Lv105-A0792 (MDK) and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... A human JUN expression vector under the CMV promoter in pEZ-MO2 was purchased from GeneCopoeia (Cat. No.: EX-B0091-M02). For siRNA transfections ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Bioengineering 2022Quote: ... HEK293Ta cells (Genecopoeia) were transfected with the purified genes using calcium phosphate nanoparticles ...
-
bioRxiv - Bioengineering 2022Quote: HEK293Ta cells were purchased from GeneCopoeia and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: ... and Lenti-Pac 293Ta cells (GeneCopoeia)(24) ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... Pseudolentiviral particles were made in HEK-293Ta cells (GeneCopoeia) by co-transfection of psPAX2 ...
-
bioRxiv - Genomics 2019Quote: ... cell culture media was refreshed and TiterBoost reagent (GeneCopoeia) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transduced with lentiviral particles (GeneCopoeia, Rockville, MD) overnight then selected and maintained in HAM’s F10 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... A549 cell line stably expressing CRISPR Cas9 nuclease (Genecopoeia) was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Cell Biology 2019Quote: ... PFN1 KO cells were generated with the pCRISPR-CG02 vector (Genecopoeia) containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia ...
-
bioRxiv - Immunology 2024Quote: ... MDA-MB-231 cell line was obtained from GeneCopoeia (Cat# SL018). THP-1 cells were cultured in RPMI-1640 medium containing 10% (vol/vol ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). The following drugs and chemicals were used as part of this study ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were co-transfected with Nup358 CRISPR-Cas9 (pCRISPR-CG01, GeneCopoeia) and pTSiN-puro-Cre constructs ...
-
bioRxiv - Cancer Biology 2021Quote: LNCaP cells were transfected with a Trib2 promoter-luciferase construct (5.6kb; Genecopoeia) using Lipofectamine 3000 transfection reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118).
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... Control cells were generated by transducing a scrambled control (Genecopoeia #CMIR-AN0001-AM039).
-
bioRxiv - Bioengineering 2023Quote: ... HEK 293T cells expressing ACE2 and TMPRSS2 were purchased from Genecopoeia (Catalog # SL222). The pseudovirus particles used in the study were procured from eEnzyme (catalog #s SCV2-PsV-Omicron ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected either with a control empty vector (GeneCopoeia, EX-NEG-Lv102) or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... Suit2 cells were transduced with ST6GAL1-expressing lentivirus (Genecopoeia, cat#LPP-M0351-Lv105-200-5) or empty vector lentivirus (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Cancer Biology 2020Quote: ... we transfected the cells with control vector or pReceiver-M39 vector expressing FXR1 (GeneCopoeia, Rockville, MD) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Immunology 2023Quote: ... . All cell lines used in this study underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). Primary human keratinocytes were derived from the foreskin of two donors of Malay ethnicity and obtained with informed consent from the Asian Skin Biobank (ASB ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: INA-6 IL-32 KO cells were lentiviral transduced using OmicsLink™ ORF lentiviral expression system from GeneCopoeia. Vector for knock in of IL-32β ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable cell lines expressing firefly luciferase were generated using lentiviral particle transduction and puromycin selection (GeneCopoeia, Rockville, MD).
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were infected with lentivirus particles (MOI=20) in presence of 8 μg/ml polybrene (GeneCopoeia, Guangzhou, China) for 24 hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...