Labshake search
Citations for GeneCopoeia :
51 - 74 of 74 citations for Recombinant Human Glypican 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO) using lentivirus particles carrying the CRISPR human sgRNA for CEACAM6 (Genecopoeia). Clones were selected using puromycin and the CEACAM6-expression knockout was confirmed by flow cytometry and Western blot.
-
bioRxiv - Cancer Biology 2022Quote: Overexpression of human MDK was performed using the ORF lentiviral expression vector pReceiver-Lv105-A0792 (MDK) and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: The long and short 3’UTRs cloned into the dual-luciferase vector miTarget vector was obtained from GeneCopoeia. HCT116 cells were plated on 6-well plates and transfected with 50ng of each plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... NGN2_GFP (NEUROG2) lentivirus was transduced as previously described at MOI 3 (GeneCopoeia cat#LPP-T7381-Lv103-A00-S). At the one-week time point NGN2_GFP+/oTau - and NGN2_GFP-/oTau + asteroids were mixed and placed in 96-well culture as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Biochemistry 2019Quote: ... U87MG cells stably expressing C-terminal 3x FLAG tagged DDX28 were generated by transfecting cells with the OmicsLink™ pEZ-M14 EX-A3144-M14 expression vector encoding the human DDX28 coding sequence (Genecopoeia). Selection was initiated 48 h post-transfection using 1 μg/mL puromycin or 400 μg/mL G418 ...
-
bioRxiv - Neuroscience 2022Quote: ... A human JUN expression vector under the CMV promoter in pEZ-MO2 was purchased from GeneCopoeia (Cat. No.: EX-B0091-M02). For siRNA transfections ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Molecular Biology 2023Quote: Full length wild Cacna2d2-3’UTR was cloned downstream of a Gaussia luciferase reporter gene in the pEZX-MT05 vector (GeneCopoeia). Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... C3H10T1/2 mesenchymal cells were transfected by the LUC-3’UTR without or with co-transfection of miR27a (MmiR3347-MR04-50, GeneCopoeia) using Lipofectamine 200 (Cat #11668027 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to perform in vitro miR-519a-3p target analysis on 3’UTR-PRNP reporter construct (vector pEZX-MT06, Genecopoeia). Cells were maintained in Advanced Dulbecco’s modified Eagle’s medium (AdDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.