Labshake search
Citations for GeneCopoeia :
1 - 50 of 56 citations for Recombinant Human FGFR2 Fc His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: His-tagged SSRP1 was PCR amplified from SSRP1 pReceiver (GeneCopoeia) using primers encoding an N-terminal His tag and NdeI/NotI cut sites for cloning into pET22b ...
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral GFP-tagged ERF (GeneCopoeia, EX-S0501-Lv122) was used to develop DU-145 ERF cells with puromycin (1μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral GFP-tagged ERF (GeneCopoeia, EX-S0501-Lv122) were used to develop PC-3 shERFA1 and PC-3 ERF OE respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... Flag-PFDN2 and Flag-VIM) and the bacterial expression vectors pReceiver-B11 (His-NSMCE2 and His-PFDN2) were purchased from Genecopoeia, Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral GFP-tagged ERF was obtained from GeneCopoeia (EX-S0501-Lv122). pCMV-CIC with myc-tag was purchased from Origene and validated previously.
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Cell Biology 2023Quote: ... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS). The stably transfected cell lines were selectively maintained in media containing DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were transfected with 10 μg of Flag-tagged HsFN3K (EX-W1392-M46, GeneCopoeia) using Calcium Phosphate Transfection protocol (43) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and human Sprr1a (GeneCopoeia, HQP060361) were employed to detect expression of Sprr1a ...
-
bioRxiv - Cancer Biology 2020Quote: ... the SUV420H2 sequence was amplified from an ORF expression clone for SUV420H2 (eGFP tagged) (EX-V0810-M98, GeneCopoeia) introducing a stop codon ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG and FLAG-tagged PCNA expressing lentiviral plasmids were purchased from GeneCopoeia (EX-NEG-Lv203 and EX-B0066-Lv203). The lentiviral constructs harboring siRNA-resistant pHAGE-HLTF-WT and R71E Hiran mutant were (Taglialatela et al. ...
-
bioRxiv - Cancer Biology 2021Quote: Human PPARGC1A cDNA was obtained from GeneCopoeia. Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Cell Biology 2022Quote: Stable cell lines expressing FLAG-tagged SLC25A1 were prepared by transfecting human neuroblastoma SH-SY5Y cells (ATCC, CRL-2266; RRID:CVCL_0019) with ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia, EX-A1932-Lv1020GS) (Gokhale et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Immunology 2021Quote: Human FOXN1 cDNA was purchased from Genecopoeia (sequence accession number BC140423). Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Cell Biology 2024Quote: The pReceiver-Lv165 human BMI1 overexpression plasmid (EX-B0015-Lv165, GeneCopoeia) and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165 ...
-
bioRxiv - Microbiology 2021Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China). Anti-RBD monoclonal antibodies (mAbs ...
-
bioRxiv - Microbiology 2020Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Microbiology 2021Quote: ... Human ACE2 and DPP4 expression plasmids were derived from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: ... The cDNA encoding human spastin (NM_014946.3) was purchased from GeneCopoeia (product ID: U1177) and was subcloned into a modified pET vector containing N-terminal 6xHis and MBP tags ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA sequences are as follows: GGTGGAGATGATCTTAAACAA (HSH005861-LVRU6GP, for Human AKR1B1, GeneCopoeia), CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01 ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Molecular Biology 2023Quote: ... CopGFP and shBAZ2A for human BAZ2A were cloned into DC-DON-SH01 vector (GeneCopoeia). Site-directed mutagenesis was performed to create BAZ2A mutants WY531/532GA (H/F-BAZ2AWY/GA ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cell Biology 2022Quote: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia). 3xFlag-GFP was used as a negative control in pull-down experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Bioengineering 2020Quote: ... Viruses were produced in HEK-293Ta cells using human lentiviral packaging system according to the manufacturer’s instructions (Genecopoeia). Puromycin was used to select only for transduced cells ...
-
bioRxiv - Neuroscience 2020Quote: ... human GSAP-16k with HA tag (a.a. 733 to a.a. 854 subcloned from full length human GSAP plasmids, EX-Z2830-M07, Genecopoeia), human Arcn1 with Myc and Flag tags (RC210778 ...
-
bioRxiv - Biophysics 2021Quote: The cDNA encoding human SSNA1 (NM_003731.2) with an N-terminal 6xHis-tag in a pReceiver-B01 vector was purchased from GeneCopoeia, Rockville ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...