Labshake search
Citations for GeneCopoeia :
1 - 50 of 59 citations for Rat LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... HA tagged hNHE6.2-FL and Cytoplasmic domain (CD) were cloned by GeneCopoeia. hNHE1-HA (3X on c-terminal ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2019Quote: ... shRNA against rat Tpm3.1 (NM_173111.1) was purchased from GeneCopoeia (RSH053175-33-mH1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2019Quote: ... The duo luciferase activities were measured using the secrete-pair dual luminescence assay kit (Genecopoeia). Each sample was run in duplicate.
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cell Biology 2024Quote: ... and the luciferase reporter activity was determined using a Dual-luciferase assay kit (GeneCopoeia, Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).
-
bioRxiv - Cell Biology 2020Quote: ... lysed and analyzed for firefly and Renilla luciferase using Luc-Pair Duo-Luciferase HS Assay Kit expression as described in the manufacturer’s protocol (Genecopoeia).
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...