Labshake search
Citations for GeneCopoeia :
51 - 89 of 89 citations for Rat CPSF7 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Microbiology 2021Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China). Anti-RBD monoclonal antibodies (mAbs ...
-
bioRxiv - Cancer Biology 2020Quote: ... USA) and guide RNA plasmids were obtained from Genecopoeia (Rockville, MD, USA). The transfected 293T cells were maintained in culture for 48-72 hours ...
-
bioRxiv - Microbiology 2020Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Microbiology 2021Quote: ... Human ACE2 and DPP4 expression plasmids were derived from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Biophysics 2019Quote: ... The plasmid of GFP-fused CD98 heavy chain was purchased from GeneCopoeia™ (EX-G00009-M98) ...
-
bioRxiv - Cell Biology 2020Quote: ... Most of the lysosomal membrane protein overexpression plasmids were purchased from GeneCopoeia. The CDS of RNF152 was purchased from Horizon Discovery ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Cell Biology 2023Quote: ... Fbh1 and Rad51 expression plasmids were obtained from GeneCopoeia (#EX-E2953-Lv105) and Addgene (CMV-hRad51 ...
-
bioRxiv - Microbiology 2021Quote: ... were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM_021804) ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids encoding FOXO1 (EX-Z7404-M02) were constructed by GeneCopoeia (Rockville, MD, USA). The hCMEC/D3 cells were plated in plates or dishes at 6 × 104 cells/cm2 ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Cell Biology 2022Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and silica column purified (Qiagen Maxiprep ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and purified via silica column (Qiagen Maxiprep ...
-
bioRxiv - Cancer Biology 2020Quote: ... all-in-one CRISPR plasmids with mCherry reporter were purchased from Genecopoeia (Cat # HCP218175-CG01, HCP216131-CG01).Cells were transfected with CRISPR plasmids ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Neuroscience 2020Quote: ... human GSAP-16k with HA tag (a.a. 733 to a.a. 854 subcloned from full length human GSAP plasmids, EX-Z2830-M07, Genecopoeia), human Arcn1 with Myc and Flag tags (RC210778 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Biochemistry 2020Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia). In the case of PPC variants ...
-
bioRxiv - Neuroscience 2022Quote: ... The mutant sequence or wild-type sequence of HDAC6 were respectively cloned on the overexpression plasmid vector Lv206 (GeneCopoeia) (Fig EV5B) ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG and FLAG-tagged PCNA expressing lentiviral plasmids were purchased from GeneCopoeia (EX-NEG-Lv203 and EX-B0066-Lv203). The lentiviral constructs harboring siRNA-resistant pHAGE-HLTF-WT and R71E Hiran mutant were (Taglialatela et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and with 500 ng plasmid expressing either miR-194-5p or a scrambled sequence as control (MR01 backbone, GeneCopoeia). 24 hours later ...
-
bioRxiv - Cancer Biology 2019Quote: Luciferase reporter plasmids containing the Wee1 mRNA3’-UTR (HmiT054534-MT06) or the Chk1 mRNA3’-UTR (HmiT061994-MT06) were purchased from GeneCopoeia. Twenty four hours before transfection ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Cancer Biology 2022Quote: A375 melanoma cells were transfected with a pEZX-PG04 plasmid expressing Gaussia luciferase (GLuc) under the influence of the PARP14 promoter (GeneCopoeia). After 48 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid DNA or siRNA was transfected using EndoFectinTM Max Transfection Reagent following the manufactureŕs instructions (#EF014, GeneCopoeia, Inc., Rockville, USA). For Odf2 knockdown ...
-
bioRxiv - Biochemistry 2023Quote: ... The antibiotic resistance gene against puromycin in a GFP or gaussia luciferase reporter plasmid (pEZX-LvPF02 or pEZX-LvPG02, GeneCopoeia) containing a YY1 promoter sequence was changed to hygromycin resistance gene ...
-
bioRxiv - Neuroscience 2021Quote: The short hairpin RNA targeting the murine expression of KMO (NM_133809.1) was designed and acquired from Genecopoeia (plasmid reference MSH037508-CU6). The in vivo transfection was performed using InVivo JetPei reagent (Polyplus ...
-
bioRxiv - Immunology 2021Quote: ... CD4-conjugated antibodies were produced in stable cell lines via transient transfection of plasmid coding light chains using EndoFectin™ Max transfection agent (GeneCopoeia). Transfected cells were incubated at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: The expression construct encoding for full length NUAK1 (NM_ 014840.2) in a lentiviral plasmid (pReceiver-Lv242) was purchased from Genecopoeia (Rockville, MD). Cell lines were transfected with NUAK1 plasmid construct using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G (gifts from Didier Trono) were chemically transfected with the transfer plasmid into the 293Ta packaging cell line (Genecopoeia, LT008) using GeneTwin transfection reagent (Biomed ...
-
bioRxiv - Cell Biology 2024Quote: ... and the transfer plasmid were chemically transfected using GeneTwin transfection reagent (Biomed, TG101) into the HEK293Ta packaging cell line (Genecopoeia, LT008). The cell culture medium was harvested after 2 days and filtered through a 0.45 μm filter ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia, Rockville, MD, USA). The obtained fragment was cloned into pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...