Labshake search
Citations for GeneCopoeia :
1 - 50 of 69 citations for Puumala Virus Glycoprotein 2 Gc Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Neuroscience 2020Quote: ... human GSAP-16k with HA tag (a.a. 733 to a.a. 854 subcloned from full length human GSAP plasmids, EX-Z2830-M07, Genecopoeia), human Arcn1 with Myc and Flag tags (RC210778 ...
-
bioRxiv - Biophysics 2021Quote: The cDNA encoding human SSNA1 (NM_003731.2) with an N-terminal 6xHis-tag in a pReceiver-B01 vector was purchased from GeneCopoeia, Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs for ABI1 full-length (Cat. GC-M0337-CF-GS) and ABI1ΔEx9 (Cat. no. GC-Z8779-CF-GS) were purchased from Genecopoeia in pShuttle vectors without stop codons and subsequently recombined using LR Clonase II into pLIX403 with an in-frame 3’-end V5 tag ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...
-
bioRxiv - Microbiology 2022Quote: SBDS in pShuttle was purchased from GeneCopoeia (Cat# GC-T0315). SPATA5 cDNA was generated from U-2 OS RNA using SuperScript IV First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Gateway PLUS shuttle clone for CYS1 was from GeneCopoeia (GC-Y0203-CF). N or C terminal LAP tagged retroviral constructs of full length and truncations of TULP3 ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Cancer Biology 2022Quote: ... shCtrl (CSHCTR001LVRU6GP) and shGJB6 Lenti-virus vector (HSH06069132LVRU6GP) were purchased from GeneCopoeia.
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Neuroscience 2020Quote: ... and Fe65 with mCherry tag (EX-Mm20316-M56) were obtained from Genecopoeia. GFP-PP1gamma (gift from Angus Lamond & Laura Trinkle-Mulcahy ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... TBX21 and GATA3 or control virus particles contained the pReceiver-LV201 vector and were obtained from GeneCopoeia. A CMV promoter was used to drive the RORC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and human Sprr1a (GeneCopoeia, HQP060361) were employed to detect expression of Sprr1a ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Human PPARGC1A cDNA was obtained from GeneCopoeia. Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Cancer Biology 2021Quote: ... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: Human FOXN1 cDNA was purchased from Genecopoeia (sequence accession number BC140423). Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Cell Biology 2024Quote: The pReceiver-Lv165 human BMI1 overexpression plasmid (EX-B0015-Lv165, GeneCopoeia) and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165 ...
-
bioRxiv - Microbiology 2021Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China). Anti-RBD monoclonal antibodies (mAbs ...
-
bioRxiv - Microbiology 2020Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Microbiology 2021Quote: ... Human ACE2 and DPP4 expression plasmids were derived from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Biophysics 2021Quote: ... The cDNA encoding human spastin (NM_014946.3) was purchased from GeneCopoeia (product ID: U1177) and was subcloned into a modified pET vector containing N-terminal 6xHis and MBP tags ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA sequences are as follows: GGTGGAGATGATCTTAAACAA (HSH005861-LVRU6GP, for Human AKR1B1, GeneCopoeia), CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01 ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Molecular Biology 2023Quote: ... CopGFP and shBAZ2A for human BAZ2A were cloned into DC-DON-SH01 vector (GeneCopoeia). Site-directed mutagenesis was performed to create BAZ2A mutants WY531/532GA (H/F-BAZ2AWY/GA ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cell Biology 2022Quote: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia). 3xFlag-GFP was used as a negative control in pull-down experiments ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...