Labshake search
Citations for GeneCopoeia :
1 - 50 of 74 citations for Primary Bovine Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Early passage (p1) of primary stroma cells were infected with Lentivirus particles for hTERT overexpression driven by EEF1A1 promoter (GeneCopoeia, LP730-025) according to the manufacture’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... HEK293Ta cells (Genecopoeia) were transfected with the purified genes using calcium phosphate nanoparticles ...
-
bioRxiv - Bioengineering 2022Quote: HEK293Ta cells were purchased from GeneCopoeia and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: ... and Lenti-Pac 293Ta cells (GeneCopoeia)(24) ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2019Quote: ... Pseudolentiviral particles were made in HEK-293Ta cells (GeneCopoeia) by co-transfection of psPAX2 ...
-
bioRxiv - Genomics 2019Quote: ... cell culture media was refreshed and TiterBoost reagent (GeneCopoeia) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transduced with lentiviral particles (GeneCopoeia, Rockville, MD) overnight then selected and maintained in HAM’s F10 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... A549 cell line stably expressing CRISPR Cas9 nuclease (Genecopoeia) was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... PFN1 KO cells were generated with the pCRISPR-CG02 vector (Genecopoeia) containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia ...
-
bioRxiv - Immunology 2024Quote: ... MDA-MB-231 cell line was obtained from GeneCopoeia (Cat# SL018). THP-1 cells were cultured in RPMI-1640 medium containing 10% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). The following drugs and chemicals were used as part of this study ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were co-transfected with Nup358 CRISPR-Cas9 (pCRISPR-CG01, GeneCopoeia) and pTSiN-puro-Cre constructs ...
-
bioRxiv - Cancer Biology 2021Quote: LNCaP cells were transfected with a Trib2 promoter-luciferase construct (5.6kb; Genecopoeia) using Lipofectamine 3000 transfection reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118).
-
bioRxiv - Cancer Biology 2021Quote: ... Control cells were generated by transducing a scrambled control (Genecopoeia #CMIR-AN0001-AM039).
-
bioRxiv - Bioengineering 2023Quote: ... HEK 293T cells expressing ACE2 and TMPRSS2 were purchased from Genecopoeia (Catalog # SL222). The pseudovirus particles used in the study were procured from eEnzyme (catalog #s SCV2-PsV-Omicron ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were transfected with 10 μg of Flag-tagged HsFN3K (EX-W1392-M46, GeneCopoeia) using Calcium Phosphate Transfection protocol (43) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected either with a control empty vector (GeneCopoeia, EX-NEG-Lv102) or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2022Quote: ... Suit2 cells were transduced with ST6GAL1-expressing lentivirus (Genecopoeia, cat#LPP-M0351-Lv105-200-5) or empty vector lentivirus (Sigma) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Cancer Biology 2020Quote: ... we transfected the cells with control vector or pReceiver-M39 vector expressing FXR1 (GeneCopoeia, Rockville, MD) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Immunology 2023Quote: ... . All cell lines used in this study underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). Primary human keratinocytes were derived from the foreskin of two donors of Malay ethnicity and obtained with informed consent from the Asian Skin Biobank (ASB ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: INA-6 IL-32 KO cells were lentiviral transduced using OmicsLink™ ORF lentiviral expression system from GeneCopoeia. Vector for knock in of IL-32β ...
-
bioRxiv - Cancer Biology 2021Quote: ... Stable cell lines expressing firefly luciferase were generated using lentiviral particle transduction and puromycin selection (GeneCopoeia, Rockville, MD).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Bioengineering 2020Quote: ... Viruses were produced in HEK-293Ta cells using human lentiviral packaging system according to the manufacturer’s instructions (Genecopoeia). Puromycin was used to select only for transduced cells ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were infected with lentivirus particles (MOI=20) in presence of 8 μg/ml polybrene (GeneCopoeia, Guangzhou, China) for 24 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Physiology 2023Quote: Huh-7 or AML12 cells (2.5 x 105) were reverse transfected in triplicate in 6 well plates using Endofectin (Genecopoeia) with the indicated doses of miRIDIAN miRNA mimics (miR-541-3p) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MT-5 cell line were also transduced to stably express luciferase using LentifectTM (GeneCopoeia #LPP-HLUC-Lv105-025-C) lentiviral vectors of firefly luciferase ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP-C4-2 cells were transduced to express ZsGreen or Firefly luciferase-mCherry by the Wake Forest Baptist Comprehensive Cancer Center (WFBCCC) Cell Engineering Shared Resource using a lentivirus (Clontech or Genecopoeia). LNCaP-C4-2 and PC3-mm were sorted into CD117+ and negative populations using the Miltenyi MACS sorting beads or the ThermoFisher MagniSort CD117 (c-kit ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for Rab7A (plasmid number HTN218819, Genecopoeia, Rockville, MD). 72 hrs post-transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Cancer Biology 2019Quote: CRYM expressing cells were generated by transfecting PCa cells with pReceiver-M72 Empty Vector and pReceiver-M72 CRYM (for simplicity referred to in the text as CRYM(+) (GeneCopoeia) containing a green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...