Labshake search
Citations for GeneCopoeia :
51 - 90 of 90 citations for Mouse Oxidation resistance protein 1 Oxr1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cell Biology 2024Quote: ... and the luciferase reporter activity was determined using a Dual-luciferase assay kit (GeneCopoeia, Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).
-
bioRxiv - Cell Biology 2020Quote: ... lysed and analyzed for firefly and Renilla luciferase using Luc-Pair Duo-Luciferase HS Assay Kit expression as described in the manufacturer’s protocol (Genecopoeia).
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was reverse-transcribed to cDNA using a high capacity cDNA Reverse Transcription Kit from GeneCopoeia (Maryland, USA). qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga ...
-
bioRxiv - Genomics 2021Quote: Lentivirus was produced in twelve 15cm dishes of 293T cells using Lenti-Pac HIV expression packaging kit following the manufacture’s protocol (GeneCopoeia, LT002). Lentivirus was filtered through a 0.45um PES filter system (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Neuroscience 2023Quote: ... Firefly and Renilla luciferase activities were measured using a Luc-Pair™ Duo-Luciferase HS Assay Kit (for high sensitivity) (GeneCopoeia). Firefly luciferase activity and Renilla luciferase activity were normalized ...
-
bioRxiv - Zoology 2021Quote: RNA was extracted and reverse-transcribed to cDNA using HiScript II Q RT SuperMix for qPCR(Vazyme, China) or All-in-One™ miRNA First-Strand cDNA Synthesis Kit (Genecopoeia,US). sigA gene or MysA was used as an internal reference ...
-
bioRxiv - Biochemistry 2022Quote: Luciferase counts were measured for cells infected with Spike-pseudotyped VSV-GFP/Fluc particles using Luc-Pair™ Firefly Luciferase HS Assay Kit (GeneCopoeia: LF009). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: CNTNAP4 KO and control-transfected cells were collected for the detection of the mutation using the T7 Endonuclease I Assay Kit (Genecopoeia, Rockville, MD). DNA was extracted from the samples using Quick-DNA™ Miniprep Kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: ... The JeKo-1 cell line expressing luciferase was generated using HLUC-Lv105 lentiviral particles (GeneCopoeia) and selected with puromycin ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Neuroscience 2020Quote: ... or with LV encoding for synapsin 1 (Syn1) fused to GFP (GeneCopoeia, Inc., cat.# LPP-Z5062-Lv103-100), for live-cell imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral particles for MART-1 expressed from an EF1a promoter with an IRES-eGFP were purchased from Genecopoeia (G0616-Lv225). GFP control was expressed using a lentiviral vector with an EF1a promoter and IRES-eGFP.
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... pGEX-GST-6P-1-GST-PHC3 was generated similarly with PCR amplification of PHC3 using pEZ-M39-PHC3-FLAG (EX-L3818-M39, Genecopoeia) and ligation into pGEX-GST-PHC2-Cerulean FLAG after digestion to remove PHC2 ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...