Labshake search
Citations for GeneCopoeia :
1 - 50 of 60 citations for Mouse NGF beta ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2019Quote: ... The duo luciferase activities were measured using the secrete-pair dual luminescence assay kit (Genecopoeia). Each sample was run in duplicate.
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cell Biology 2024Quote: ... and the luciferase reporter activity was determined using a Dual-luciferase assay kit (GeneCopoeia, Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).