Labshake search
Citations for GeneCopoeia :
1 - 50 of 71 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or control empty (Genecopoeia) vector were generated in HEK293FT packaging cell line (complete medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... Control cells were generated by transducing a scrambled control (Genecopoeia #CMIR-AN0001-AM039).
-
bioRxiv - Immunology 2023Quote: ... or Empty control vector (GeneCopoeia) were used ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Cancer Biology 2020Quote: ... or GFP control (EX-EGFP-Lv105, GeneCopoeia) plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... the eGFP control (EX-EGFP-Lv105; GeneCopoeia) the packaging plasmid (psPAX2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is used as internal transfection control (GeneCopoeia).
-
bioRxiv - Molecular Biology 2019Quote: ... Control and miR-100 doxycycline inducible overexpression vectors (GeneCopoeia, MD) were created and then integrated into the genomes of tumor cells with lentiviruses ...
-
bioRxiv - Cancer Biology 2021Quote: ... a control luciferase reporter plasmid (CmiT000001-MT06; GeneCopoeia, Rockville, USA) or FGFR1-3’UTR target plasmid (HmiT005432-MT06 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding LAR shRNA and scrambled controls were purchased from GeneCopoeia. Packaging (pCMVR8.74 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the expressing vector of CypD or control vector (GeneCopoeia, Rockville, MD) was transiently transfected into RAW264.7 cells using PolyMag Neo (PG60200 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a EGFP overexpression plasmid as control plasmid (#EX-EGFP-Lv151, Genecopoeia). Cell lines were transduced at high MOI as previously described68 with overnight virus incubation.
-
bioRxiv - Cancer Biology 2020Quote: ... The DPF1 shRNA and the corresponding Scrambled shRNA control were purchased from Genecopoeia. The vector was psi-LVRU6GP and the target sequences were ...
-
bioRxiv - Cell Biology 2021Quote: ... Control scrambled miRNA (“Scr”; Cat# AA08-CmiR0001-MR14-100, GeneCopoeia Inc, MD, USA) and miR-181c (“miR-181c OE” ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles expressing CCL2-CXCL9 fusion protein and negative control were purchased from GeneCopoeia.
-
bioRxiv - Cancer Biology 2020Quote: ... TS expression vector (Ex-T0406-LV105b) and control vector (Ex-Neg-LV105b) are from GeneCopoeia. For production of lentiviral particles ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50ng of either control (empty) vector or fully sequenced ERF cDNA (GeneCopoeia (EX-S0501-Lv122)) ...
-
bioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells were transfected either with a control empty vector (GeneCopoeia, EX-NEG-Lv102) or ORF expression clone containing N terminally tagged FLAG-SLC25A1 (GeneCopoeia ...
-
bioRxiv - Microbiology 2020Quote: ... and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia) at a concentration of 4,9E−9 GC/mL and 1,2E−9 GC/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Cancer Biology 2020Quote: ... we transfected the cells with control vector or pReceiver-M39 vector expressing FXR1 (GeneCopoeia, Rockville, MD) using Lipofectamine 2000 (Invitrogen ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... TBX21 and GATA3 or control virus particles contained the pReceiver-LV201 vector and were obtained from GeneCopoeia. A CMV promoter was used to drive the RORC ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Molecular Biology 2023Quote: ... and with 500 ng plasmid expressing either miR-194-5p or a scrambled sequence as control (MR01 backbone, GeneCopoeia). 24 hours later ...
-
bioRxiv - Cancer Biology 2021Quote: ... Vector for knock in of IL-32β: (transcript variant 8) EX-M0733-Lv121 and control vector: EX-EGFP-Lv121 were purchased from GeneCopoeia. Lentiviral packaging and transduction of cells were performed as described above and transduced cells were subjected to negative selection using puromycin.
-
bioRxiv - Neuroscience 2020Quote: ... REST overexpression was performed by transducing DRG neurons with lentiviral constructs containing either REST (Lv135-REST) or humanized luciferase protein (Lv135-hLuc) as a control driven by the CMV promoter (GeneCopoeia). DRG neurons were replated 7 days after the viral infection ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: The SERPINB3 construct (EX-F0390-Lv103) and the corresponding empty vector control (EX-NEG-Lv103) were purchased from Genecopoeia (Rockville, MD). To obtain stable cell lines overexpressing SERPINB3 ...
-
bioRxiv - Cancer Biology 2023Quote: The ELAPOR1 construct (EX-L2758-Lv122) and the corresponding empty vector control (EX-NEG-Lv122) were purchased from Genecopoeia (Rockville, MD). To establish stable cell lines overexpressing ELAPOR1 ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: CNTNAP4 KO and control-transfected cells were collected for the detection of the mutation using the T7 Endonuclease I Assay Kit (Genecopoeia, Rockville, MD). DNA was extracted from the samples using Quick-DNA™ Miniprep Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2021Quote: ... Lipofectamine 2000 has been used to transfect MIN6 cells with CRTC1 overexpressing plasmid (EX-Mm18750-Lv183) or with control plasmid (EX-EGFP-Lv151) (both from Genecopoeia, Rockville, MD, USA). Lipotoxic stress has been induced by using 0.5 mM of sodium palmitate (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... miR-495-3p (HmiR0226-MR03), AntagomiR-495-3p (MmiR-AN0537-AM04), and control vectors (CmiR0001-MR03 and CmiR-AN0001-AM04, respectively) all from GeneCopoeia (Rockville, MD, USA). Lentiviral particles were produced and used for transduction at a MOI of 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...