Labshake search
Citations for GeneCopoeia :
1 - 50 of 100 citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA plasmids were procured from Genecopoeia (Rockville, MD, USA), and overexpression plasmids were obtained from AddGene (Watertown ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids encoding LAR shRNA and scrambled controls were purchased from GeneCopoeia. Packaging (pCMVR8.74 ...
-
bioRxiv - Developmental Biology 2023Quote: A shRNA plasmid clone set targeting Dlc1 was obtained from GeneCopoeia (MSH100727-LVRU6MP). Each set contains 3 shRNA expression constructs and 1 scrambled shRNA control ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA were from Genecopoeia, hygromycin selection ...
-
bioRxiv - Cancer Biology 2020Quote: ... The DPF1 shRNA and the corresponding Scrambled shRNA control were purchased from Genecopoeia. The vector was psi-LVRU6GP and the target sequences were ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Cell Biology 2022Quote: ... MAFA shRNA (Genecopoeia, Rockville, MD), and MAFB shRNA (VectorBuilder ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentivirus particles were made using HEK293 cells (ATCC) transfected with 2nd generation packaging/envelope plasmids (Dr. Yasuhiro Ikeda, Mayo Clinic) and shRNA clones (GeneCopoeia). U251 cells were obtained from American Type Cell Culture and maintained for in vitro experiments in DMEM supplemented with 10% FBS and 1% Antibiotic Antimycotic Solution ...
-
bioRxiv - Neuroscience 2020Quote: ... WDR81 shRNA was provided by Genecopoeia™ ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Biochemistry 2019Quote: Two unique OmicsLink™ shRNA expression vectors (Genecopoeia) were used to target the coding sequence of human DDX28 [HSH014712-3-nU6 sequence 5’-ggtggactacatcttagag-3’ ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... Pcx-targeting shRNA were purchased from Genecopoeia (Rockville, MD) in a psi-LVRU6H vector ...
-
bioRxiv - Neuroscience 2019Quote: ... shRNA against rat Tpm3.1 (NM_173111.1) was purchased from GeneCopoeia (RSH053175-33-mH1 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Lentivirus-shRNA p62/Sqstm1 (Product ID: MSH093992, Accession: NM_011018.3, GeneCopoeia) were used to express miR-27a and knockdown p62 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 10 μg of the following anti-FOXM1 shRNA from Genecopoeia: sh-C (5’-TAATACGACTCACTATAGGG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA sequences are as follows: GGTGGAGATGATCTTAAACAA (HSH005861-LVRU6GP, for Human AKR1B1, GeneCopoeia), CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01 ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a EGFP overexpression plasmid as control plasmid (#EX-EGFP-Lv151, Genecopoeia). Cell lines were transduced at high MOI as previously described68 with overnight virus incubation.
-
bioRxiv - Neuroscience 2022Quote: ... 5μg of FLAG-Prrt2 plasmid (GeneCopoeia) and 5μg of SNARE plasmid (T7- VAMP2 or myc-STX1A ...
-
bioRxiv - Immunology 2023Quote: ... Ndufa4l2 plasmid (EX-J0135-M02, GeneCopoeia) or Empty control vector (GeneCopoeia ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2019Quote: ... the packaging plasmid (psPAX2) and the envelope plasmid (pMD2.G) were amplified in E.coli (GCI-L3; GeneCopoeia), and purified with a silica column (Qiagen Maxiprep) ...
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for Rab7A (plasmid number HTN218819, Genecopoeia, Rockville, MD). 72 hrs post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... One plasmid on the pCRISPR-CG01 backbone (GeneCopoeia) codes for recombinant Cas9 and a sgRNA (5’-GCCAAACATAAGTGACCAAC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: Plasmids used in this study were purchased from GeneCopoeia or OriGene ...
-
bioRxiv - Developmental Biology 2021Quote: ... pReceiverM04-GST-CTBP2 and pReceiverM04-GST-GFP plasmids (GeneCopoeia) 24 hours later ...
-
bioRxiv - Microbiology 2020Quote: ... The second plasmid on the pDONOR-D01 backbone (GeneCopoeia) has a mCherry-T2A-Puro reporter cassette flanked by homology regions adjacent to the sgRNA target site in the genome ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FGFR1-3’UTR target plasmid (HmiT005432-MT06; GeneCopoeia) was co-transfected with 50 nM NCm or miR-22m into 293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Biochemistry 2023Quote: ... Other plasmids used include pReceiver M14 PINK1-3xFLAG (Genecopoeia), denoted as PINK1-3xFLAG ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... custom COL2A1-Gaussia Luciferase plasmid (HPRM22364-LvPG02, GeneCopoeia, Inc.), envelope (pMD2.G ...
-
bioRxiv - Cell Biology 2021Quote: ... Lipofectamine 2000 has been used to transfect MIN6 cells with CRTC1 overexpressing plasmid (EX-Mm18750-Lv183) or with control plasmid (EX-EGFP-Lv151) (both from Genecopoeia, Rockville, MD, USA). Lipotoxic stress has been induced by using 0.5 mM of sodium palmitate (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... pCas-guide plasmids were co-transfected with pDonor-D09 (GeneCopoeia), which carries a Puromycin resistance cassette ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids N-flag-HAT1wt (GeneCopoeia, Cat# EX-I0105-M13-11) and pCMVβ-p300-myc (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... a control luciferase reporter plasmid (CmiT000001-MT06; GeneCopoeia, Rockville, USA) or FGFR1-3’UTR target plasmid (HmiT005432-MT06 ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: ... a pReceiver-Lv205-based expression plasmid (Genecopoeia, Rockville, MD, USA) was modified stepwise to harbor a pQCXIP-based expression cassette ...
-
bioRxiv - Cell Biology 2022Quote: ... Custom ordered COL2A1-Gaussia Luciferase plasmid (HPRM22364-LvPG02, GeneCopoeia, Inc.), envelope (pMD2.G ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Cell Biology 2020Quote: CPT1A plasmid with neomycin selection marker (A1436) was purchased from GeneCopoeia. Plasmid transfections were performed with Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-Cas9 knockout plasmids were obtained from Genecopoeia (Rockville, MD, USA) and overexpression plasmids were obtained from GenScript (Piscataway ...