Labshake search
Citations for GeneCopoeia :
1 - 50 of 71 citations for Mouse Carboxyl Terminal PDZ Ligand Of Neuronal Nitric Oxide Synthase Protein NOS1AP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The cDNAs of mouse PS Synthase I (PtdSSI, PSSI) and II (PtdSSII, PSSII) were obtained from GeneCopoeia, Inc ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Microbiology 2021Quote: ... McLellan) with a removable C-terminal twin-strep tag was transfected into cells with EndoFectin Max (GeneCopoeia) using the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2021Quote: The cDNA encoding human SSNA1 (NM_003731.2) with an N-terminal 6xHis-tag in a pReceiver-B01 vector was purchased from GeneCopoeia, Rockville ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: cDNAs cloned and inserted into pReceiver-M03 vector driven by CMV promoter with c-terminal GFP were purchased from Genecopoeia (Alox12 ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and M protein (YP_009724393.1) tagged at the C-terminus with green fluorescent protein (Ex-NV225-M03) were from GeneCopoeia (Rockland, MD, U.S.A). The control plasmid was pCMV-3Tag-3A (pCMV ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... Most of the lysosomal membrane protein overexpression plasmids were purchased from GeneCopoeia. The CDS of RNF152 was purchased from Horizon Discovery ...
-
bioRxiv - Systems Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (33 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pShuttle Gateway PLUS ORF Clone for mouse CCN4 (GC-Mm21303, GeneCopoeia). Lentiviruses were packaged as described (11 ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles expressing CCL2-CXCL9 fusion protein and negative control were purchased from GeneCopoeia.
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Microbiology 2020Quote: ... and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia) at a concentration of 4,9E−9 GC/mL and 1,2E−9 GC/mL ...
-
bioRxiv - Bioengineering 2019Quote: ... was PCR-amplified and fused to the extracellular domain of mouse FcγRI (GeneCopoeia, Rockville, MD) via overlap PCR amplification ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Immunology 2021Quote: The lentiviral shRNA vector set targeting mouse Vcan (NM_019389.2) and scrambled control were purchased from GeneCopoeia (#MSH080253-LVRU6H and #CSHCTR001-LVRU6H) ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Physiology 2020Quote: ... The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville, MD; Cat. #EX-Mm30453-M61). All HCN4 experiments were performed in stable cell lines ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Cancer Biology 2019Quote: The bacterial expression vectors pReceiver-B11 for His-NSMCE2 and His-PFDN2 recombinant protein expression were purchased from Genecopoeia, Inc (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... REST overexpression was performed by transducing DRG neurons with lentiviral constructs containing either REST (Lv135-REST) or humanized luciferase protein (Lv135-hLuc) as a control driven by the CMV promoter (GeneCopoeia). DRG neurons were replated 7 days after the viral infection ...
-
bioRxiv - Cell Biology 2021Quote: ... WT and SIRT1 KO E14 mESCs were generated by CRISPR/Cas9 mediated gene editing technology using lentivirus carrying either all-in-one empty vector pCRISPR-CG01 vector or pCRISPR-CG01 containing different sgRNAs targeting mouse Sirt1 gene (GeneCopoeia). Stable single colonies were picked up and screened with immunoblotting assay using anti-SIRT1 antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2019Quote: ... The duo luciferase activities were measured using the secrete-pair dual luminescence assay kit (Genecopoeia). Each sample was run in duplicate.
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...