Labshake search
Citations for GeneCopoeia :
1 - 50 of 73 citations for Mouse Anti Human Papilloma virus type 18 718 15 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Neuroscience 2020Quote: ... To upregulate NMDAR expression in a cell-type-specific manner, mouse GluN1 cDNA (OMu21895D, Genescript) and mouse GluN2B cDNA (EX-Mm24581-M02, Genecopoeia) were cloned to custom-made vectors ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Cancer Biology 2022Quote: ... shCtrl (CSHCTR001LVRU6GP) and shGJB6 Lenti-virus vector (HSH06069132LVRU6GP) were purchased from GeneCopoeia.
-
bioRxiv - Cancer Biology 2020Quote: ... 15 μg of mATP1a1 (EX-Mm01329-Lv105, GeneCopoeia) or GFP control (EX-EGFP-Lv105 ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... TBX21 and GATA3 or control virus particles contained the pReceiver-LV201 vector and were obtained from GeneCopoeia. A CMV promoter was used to drive the RORC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and human Sprr1a (GeneCopoeia, HQP060361) were employed to detect expression of Sprr1a ...
-
bioRxiv - Cancer Biology 2021Quote: Human PPARGC1A cDNA was obtained from GeneCopoeia. Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid DNA (15 µg) and 50 µL of Endofectin Max (Genecopoeia) were each diluted to 750 µL with Opti-MEM™ in separate tubes ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Cancer Biology 2021Quote: ... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Immunology 2021Quote: ... containing mouse CD4-eYFP (GeneCopoeia), into a pcDNA3.1 tGFP-P2A-mCherry vector ...
-
bioRxiv - Biochemistry 2020Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia). In the case of PPC variants ...
-
bioRxiv - Neuroscience 2022Quote: ... The mutant sequence or wild-type sequence of HDAC6 were respectively cloned on the overexpression plasmid vector Lv206 (GeneCopoeia) (Fig EV5B) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: Human FOXN1 cDNA was purchased from Genecopoeia (sequence accession number BC140423). Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Cell Biology 2024Quote: The pReceiver-Lv165 human BMI1 overexpression plasmid (EX-B0015-Lv165, GeneCopoeia) and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Biochemistry 2020Quote: MIN6 cells were grown to ∼50% confluency in 100 mm dishes and then batch transfected with 1 µg of wild type pre-miR-200c (MmiR-3304-MR04, Genecopoeia) or mutant pre-miR-200c (Synthesized by Genscript ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Microbiology 2021Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China). Anti-RBD monoclonal antibodies (mAbs ...
-
bioRxiv - Microbiology 2020Quote: ... The expression plasmid for human ACE2 was obtained from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Microbiology 2021Quote: ... Human ACE2 and DPP4 expression plasmids were derived from GeneCopoeia (Guangzhou, China).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: ... The cDNA encoding human spastin (NM_014946.3) was purchased from GeneCopoeia (product ID: U1177) and was subcloned into a modified pET vector containing N-terminal 6xHis and MBP tags ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA sequences are as follows: GGTGGAGATGATCTTAAACAA (HSH005861-LVRU6GP, for Human AKR1B1, GeneCopoeia), CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified by PCR using a purchased plasmid encoding a complete Homo sapiens Dicer1 ribonuclease type III sequence (PubMed, NM_030621) (GeneCopoeia, Rockville, MD, USA). The obtained fragment was cloned into pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Molecular Biology 2023Quote: ... CopGFP and shBAZ2A for human BAZ2A were cloned into DC-DON-SH01 vector (GeneCopoeia). Site-directed mutagenesis was performed to create BAZ2A mutants WY531/532GA (H/F-BAZ2AWY/GA ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cell Biology 2022Quote: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia). 3xFlag-GFP was used as a negative control in pull-down experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Biophysics 2020Quote: Plasmids encoding C-terminal eGFP-labeled full-length human LIM proteins were purchased from GeneCopoeia in the m98 vector ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pCMV-SPORT6-Rab11a (mouse) was purchased from GeneCopoeia Inc ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Bioengineering 2020Quote: ... Viruses were produced in HEK-293Ta cells using human lentiviral packaging system according to the manufacturer’s instructions (Genecopoeia). Puromycin was used to select only for transduced cells ...
-
bioRxiv - Neuroscience 2020Quote: ... human GSAP-16k with HA tag (a.a. 733 to a.a. 854 subcloned from full length human GSAP plasmids, EX-Z2830-M07, Genecopoeia), human Arcn1 with Myc and Flag tags (RC210778 ...
-
bioRxiv - Biophysics 2021Quote: The cDNA encoding human SSNA1 (NM_003731.2) with an N-terminal 6xHis-tag in a pReceiver-B01 vector was purchased from GeneCopoeia, Rockville ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-FLAG (Genecopoeia) and anti-KDEL (Enzo Life Sciences ...
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...