Labshake search
Citations for GeneCopoeia :
1 - 50 of 87 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The qRT-PCR was performed using RT² SYBR Green qPCR Mastermix and Primer mix (GeneCopoeia, Rockville, Maryland, USA) for measuring human microglial gene expression in iMicroglia (tmem119 ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... The Luc-Pair miR Luciferase assay kit (GeneCopoeia, Rockville, MD) was used to measure firefly and Renilla luciferase activity according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... using Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia, cat# LF032), following the manufacturer protocol.
-
bioRxiv - Microbiology 2022Quote: ... and processed as directed (Secrete-Pair Luminescence, GeneCopoeia, Inc. Rockville, MD), followed by luminescence detection (Synergy H1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The dual luciferase reporter system (Secrete-Pair ™ Dual Luminescence Assay, GeneCopoeia, MD) allowed the normalization of luminescence to minimize variations in transfection efficiencies and cell viability ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with 2X All-in-One qPCR Mix (Genecopoeia Catalog#: QP001) using the following reaction mix ...
-
bioRxiv - Microbiology 2021Quote: ... were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM_021804) ...
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mouse Sprr1a (GeneCopoeia, MQP028278) and human Sprr1a (GeneCopoeia ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2024Quote: ... luciferase activity was measured using the Luc-Pair Duo-Luciferase assay kit 2.0 procured from Genecopoeia (#LF001) on a Biotek Cytation 3 plate reader following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... We used specific primers (Genecopoeia, Rockville, MD, USA) to amplify the cDNA samples and then normalized the obtained CT values with the housekeeping gene Gapdh ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA was also subjected to qPCR with All-in-One qPCR Mix (QP001; GeneCopoeia, Rockville, MD, USA) using the Mx3005P qPCR system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... using All-in-One qPCR Mix (GeneCopoeia). Quantitative PCR consisted of 40 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... lysed and analyzed for firefly and Renilla luciferase using Luc-Pair Duo-Luciferase HS Assay Kit expression as described in the manufacturer’s protocol (Genecopoeia).
-
bioRxiv - Immunology 2024Quote: ... 24 hours post- transfection the dual-luciferase assay was performed using Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia). Luminescence was measured using the LUMIstar Omega plate reader (BMG Labtech).
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Cell Biology 2024Quote: Luciferase reporter assays were used to measure IL6 promoter activity using the Secrete-Pair™ Dual Luminescence Assay Kit (GeneCopoeia) following the manufacturer’s instructions ...
-
Decreased Astrocytic CCL5 by MiR-324-5p Ameliorates Ischemic Stroke Injury via CCR5/ERK/CREB PathwaybioRxiv - Neuroscience 2024Quote: ... MiRNA-324-5p primers were purchased from Genecopoeia (Cat# MmiRQP0412). RT-PCR amplifications and real-time detection were performed using an Applied Biosystems 7500 Real-Time PCR System ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNAs were subjected to real-time qPCR in a Step-One Plus system (Applied Biosystem) using The All-in-One qPCR Mix (GeneCopoeia, #QP001-01). Sequences of oligonucleotides used are ...
-
bioRxiv - Neuroscience 2023Quote: ... Firefly and Renilla luciferase activities were measured using a Luc-Pair™ Duo-Luciferase HS Assay Kit (for high sensitivity) (GeneCopoeia). Firefly luciferase activity and Renilla luciferase activity were normalized ...
-
bioRxiv - Neuroscience 2020Quote: ... The All-in-One qPCR Mix (GeneCopoeia, #QP001-01) was used to perform RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Microbiology 2024Quote: ... and the All-in-one 2x qPCR mix (GeneCopoeia), utilizing specific VACV primers targeting the C11R gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... The miProfileMouse miRNome miRNA qPCR Array (catalog QM002; GeneCopoeia) was used to analyze 834 mouse miRNAs.
-
bioRxiv - Molecular Biology 2023Quote: ... and human Sprr1a (GeneCopoeia, HQP060361) were employed to detect expression of Sprr1a ...
-
bioRxiv - Biochemistry 2022Quote: Luciferase counts were measured for cells infected with Spike-pseudotyped VSV-GFP/Fluc particles using Luc-Pair™ Firefly Luciferase HS Assay Kit (GeneCopoeia: LF009). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... The human NR4H1 (FXR) expression vector and human ASBT expression vector were purchased from GeneCopoeia. HEK293T cells were cultured and co-transfected with the human FXR expression vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... using All-in-One SYBR® Green qPCR Mix (GeneCopoeia) with specific pairs of primers for hsp-60 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for IL-8 and IL-1α were purchased from GeneCopoeia (Rockville, MD). VEGFA was amplified (95°C-15 sec ...
-
bioRxiv - Cancer Biology 2021Quote: Human PPARGC1A cDNA was obtained from GeneCopoeia. Lentiviral shRNA constructs for PPARGC1A were purchased from Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using All-in-one qPCR Mix (GeneCopoeia, QP005) with primers specific for E3L ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification was performed with commercially available gene specific primers for Akt and Cacna2d2 (GeneCopoeia) and PCR products were then run on a 2% agarose gel.
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed using BlazeTaq SYBR Green qPCR Mix 2.0 (GeneCopoeia, QP031) with CFX384 Real-Time system (BIO-RAD).
-
bioRxiv - Cancer Biology 2021Quote: ... CAATGCCTGCTACATGGAGGA (CS-HSH1530L-LVRU6GP-01, for Human HKs, GeneCopoeia). Lentivirus was packed using the Dharmacon Trans-Lentiviral ORF Packaging Kit with Calcium Phosphate (TLP5916) ...
-
bioRxiv - Biochemistry 2022Quote: A plasmid expressing human ALDH9A1 was purchased from Genecopoeia. The ALDH9A1 gene was inserted in a vector (EX-Z3075-M29 ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: Human FOXN1 cDNA was purchased from Genecopoeia (sequence accession number BC140423). Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG ...
-
bioRxiv - Cell Biology 2024Quote: The pReceiver-Lv165 human BMI1 overexpression plasmid (EX-B0015-Lv165, GeneCopoeia) and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human TROP2 cDNA was used to generate hTROP2 expressing plasmid (GeneCopoeia), and empty vector (EV ...