Labshake search
Citations for GeneCopoeia :
51 - 100 of 107 citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO) using lentivirus particles carrying the CRISPR human sgRNA for CEACAM6 (Genecopoeia). Clones were selected using puromycin and the CEACAM6-expression knockout was confirmed by flow cytometry and Western blot.
-
bioRxiv - Cancer Biology 2022Quote: Overexpression of human MDK was performed using the ORF lentiviral expression vector pReceiver-Lv105-A0792 (MDK) and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... NGN2_GFP (NEUROG2) lentivirus was transduced as previously described at MOI 3 (GeneCopoeia cat#LPP-T7381-Lv103-A00-S). At the one-week time point NGN2_GFP+/oTau - and NGN2_GFP-/oTau + asteroids were mixed and placed in 96-well culture as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Biochemistry 2019Quote: ... U87MG cells stably expressing C-terminal 3x FLAG tagged DDX28 were generated by transfecting cells with the OmicsLink™ pEZ-M14 EX-A3144-M14 expression vector encoding the human DDX28 coding sequence (Genecopoeia). Selection was initiated 48 h post-transfection using 1 μg/mL puromycin or 400 μg/mL G418 ...
-
bioRxiv - Neuroscience 2022Quote: ... A human JUN expression vector under the CMV promoter in pEZ-MO2 was purchased from GeneCopoeia (Cat. No.: EX-B0091-M02). For siRNA transfections ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Molecular Biology 2023Quote: Full length wild Cacna2d2-3’UTR was cloned downstream of a Gaussia luciferase reporter gene in the pEZX-MT05 vector (GeneCopoeia). Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... C3H10T1/2 mesenchymal cells were transfected by the LUC-3’UTR without or with co-transfection of miR27a (MmiR3347-MR04-50, GeneCopoeia) using Lipofectamine 200 (Cat #11668027 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to perform in vitro miR-519a-3p target analysis on 3’UTR-PRNP reporter construct (vector pEZX-MT06, Genecopoeia). Cells were maintained in Advanced Dulbecco’s modified Eagle’s medium (AdDMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).
-
bioRxiv - Cell Biology 2020Quote: ... lysed and analyzed for firefly and Renilla luciferase using Luc-Pair Duo-Luciferase HS Assay Kit expression as described in the manufacturer’s protocol (Genecopoeia).
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was reverse-transcribed to cDNA using a high capacity cDNA Reverse Transcription Kit from GeneCopoeia (Maryland, USA). qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga ...
-
bioRxiv - Genomics 2021Quote: Lentivirus was produced in twelve 15cm dishes of 293T cells using Lenti-Pac HIV expression packaging kit following the manufacture’s protocol (GeneCopoeia, LT002). Lentivirus was filtered through a 0.45um PES filter system (Thermo Scientific ...