Labshake search
Citations for GeneCopoeia :
1 - 50 of 112 citations for Cow T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... CD4-conjugated antibodies were produced in stable cell lines via transient transfection of plasmid coding light chains using EndoFectin™ Max transfection agent (GeneCopoeia). Transfected cells were incubated at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Biophysics 2019Quote: ... The plasmid of GFP-fused CD98 heavy chain was purchased from GeneCopoeia™ (EX-G00009-M98) ...
-
bioRxiv - Immunology 2021Quote: ... and transfected with CD4-IgH plasmid encoding domains 1 and 2 of CD4 fused to the N-terminus of the heavy chain of selected nnAbs using EndoFectin™ Max transfection reagent (GeneCopoeia) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Genomics 2021Quote: Lentivirus was produced in twelve 15cm dishes of 293T cells using Lenti-Pac HIV expression packaging kit following the manufacture’s protocol (GeneCopoeia, LT002). Lentivirus was filtered through a 0.45um PES filter system (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: Luciferase counts were measured for cells infected with Spike-pseudotyped VSV-GFP/Fluc particles using Luc-Pair™ Firefly Luciferase HS Assay Kit (GeneCopoeia: LF009). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: CNTNAP4 KO and control-transfected cells were collected for the detection of the mutation using the T7 Endonuclease I Assay Kit (Genecopoeia, Rockville, MD). DNA was extracted from the samples using Quick-DNA™ Miniprep Kit (Zymo Research ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were packaged into 3rd generation replication deficient lenti-virus in HEK-293T cells using the Lenti-Pac HIV Expression Packaging Kit (Genecopoeia, Rockville, Maryland, USA) following manufacturer’s protocol (Cat# LT001).
-
bioRxiv - Bioengineering 2022Quote: ... HEK293Ta cells (Genecopoeia) were transfected with the purified genes using calcium phosphate nanoparticles ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Bioengineering 2022Quote: HEK293Ta cells were purchased from GeneCopoeia and maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Immunology 2021Quote: ... and Lenti-Pac 293Ta cells (GeneCopoeia)(24) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Cell Biology 2019Quote: ... Pseudolentiviral particles were made in HEK-293Ta cells (GeneCopoeia) by co-transfection of psPAX2 ...
-
bioRxiv - Genomics 2019Quote: ... cell culture media was refreshed and TiterBoost reagent (GeneCopoeia) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transduced with lentiviral particles (GeneCopoeia, Rockville, MD) overnight then selected and maintained in HAM’s F10 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... A549 cell line stably expressing CRISPR Cas9 nuclease (Genecopoeia) was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 0.5 μg POM121-GFP plasmid (Genecopoeia) using Nanojuice transfection reagent ...
-
bioRxiv - Neuroscience 2019Quote: ... The duo luciferase activities were measured using the secrete-pair dual luminescence assay kit (Genecopoeia). Each sample was run in duplicate.
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... PFN1 KO cells were generated with the pCRISPR-CG02 vector (Genecopoeia) containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia ...
-
bioRxiv - Immunology 2024Quote: ... MDA-MB-231 cell line was obtained from GeneCopoeia (Cat# SL018). THP-1 cells were cultured in RPMI-1640 medium containing 10% (vol/vol ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118). The following drugs and chemicals were used as part of this study ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were co-transfected with Nup358 CRISPR-Cas9 (pCRISPR-CG01, GeneCopoeia) and pTSiN-puro-Cre constructs ...
-
bioRxiv - Cancer Biology 2021Quote: LNCaP cells were transfected with a Trib2 promoter-luciferase construct (5.6kb; Genecopoeia) using Lipofectamine 3000 transfection reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... All cell lines underwent routine mycoplasma testing with MycoGuard (Genecopoeia #LT07-118).
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.