Labshake search
Citations for GeneCopoeia :
1 - 50 of 64 citations for Cow Eukaryotic Translation Initiation Factor 1 EIF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and C-HaloTag-EGFR (EX-A8661-M50, accession number: NM_005228.4, Homo sapiens epidermal growth factor receptor) constructs were from Genecopoeia (Rockville, MD). AlexaFluor488 Halo ligand (AF-488 ...
-
bioRxiv - Neuroscience 2022Quote: ... Lenti-Pac™ HIV Expression Packaging Kit (GeneCopoeia) was used for transfection in 293T cell line following the instructions of the kit ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Luc-Pair Duo-Luciferase HS Assay Kit (GeneCopoeia) according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2020Quote: A lentiviral packaging kit was used to produce lentiviruses (Genecopoeia). The tension sensor and controls plasmids were co-transfected with lentiviral plasmids into HEK 293Ta packaging cells according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... as instructed in a packing kit (GeneCopoeia, Inc., Guangzhou, China). Then ...
-
bioRxiv - Molecular Biology 2022Quote: AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
bioRxiv - Neuroscience 2024Quote: ... provided in IndelCheck™ kit purchased from GeneCopoeia (Cat# IC001), into each well followed by use of a cell scrapper ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA was obtained using Superscript First Strand cDNA synthesis kit (GeneCopoeia). qPCR was performed using Taqman probes for the indicated gene (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005), and LC-MS/MS.
-
bioRxiv - Molecular Biology 2024Quote: ... T7 endonuclease I assay kit following the manual’s protocol (GeneCopoeia, Cat# IC005) (F ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Genomics 2019Quote: ... were used to generate lentivirus using the Lenti-Pac HIV expression packaging kit (GeneCopoeia). Lentivirus was concentrated using the Lenti-X Concentrator (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... and titrated using the Lenti- Pac™ HIV qRT-PCR Titration Kit (GeneCopoeia, LT005). The dCas9-KRAB and dCas9- VP64 stably expressed HAP1 cell lines were seeded into a 24-well plate and transfected with the concentrated sgRNA library at MOI=500 (moderate MOI) ...
-
bioRxiv - Immunology 2023Quote: ... Cell lysates were analyzed with Luc-Pair Duo-Luciferase assay kit (GeneCopoeia; cat # LF003) using a VICTOR Nivo multimode microplate reader (PerkinElmer ...
-
bioRxiv - Neuroscience 2019Quote: ... The duo luciferase activities were measured using the secrete-pair dual luminescence assay kit (Genecopoeia). Each sample was run in duplicate.
-
bioRxiv - Plant Biology 2021Quote: ... Firefly luciferase activity was quantified using the Luc-Pair Firefly Luciferase HT Assay Kit (GeneCopoeia). GUS activity was measured by the fluorimetric GUS assay ...
-
bioRxiv - Cancer Biology 2023Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Bioengineering 2020Quote: ... ViaQuant™ Fixable Far-Red Dead Cell Staining Kit was purchased from GeneCopoeia (Rockville, MD, USA). Alexa Fluor 488-phalloidin was purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Microbiology 2022Quote: Gaussia luciferase activity was determined using Luc-Pair Renilla luciferase HS assay kit (GeneCopoeia, Rockville, MD). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of A33 protein was performed by using the biotin-protein ligase kit (GeneCopoeia™, B1001) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Renilla and Firefly luciferase activities were measured by the Dual-Luciferase Reporter Assay Kit 2.0 (GeneCopoeia) using a Tecan Infinite 200 Pro microplate reader (Tecan ...
-
bioRxiv - Immunology 2020Quote: ... All cell lines were tested for mycoplasma using MycoGuard Mycoplasma PCR Detection Kit (GeneCopoeia, Rockville, MD) every 3–6 months ...
-
bioRxiv - Molecular Biology 2024Quote: ... the luciferase assay was conducted with the Luc-Pair Luciferase Assay Kit 2.0 (LF001-GC, GeneCopoeia), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Biophysics 2020Quote: ... Biotinylation reaction was performed in accordance with the instructions provided by the BirA enzyme kit (GeneCopoeia™). Reaction was conducted including 40 μM dye-labelled OmpC with AviTag ...
-
bioRxiv - Molecular Biology 2020Quote: ... the secreted GLuc and SEAP activities were measured using the Secrete-Pair Dual Luminescence Assay Kit (GeneCopoeia), according to manufacturer’s protocol using a plate reader (SpectraMax i3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luciferase and alkaline phosphatase activities were assayed using the Secrete-Pair™ Dual Luminescence assay kit (Genecopoeia) and read on the Centro XS3 LB960 Microplate Luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Gaussia luciferase activity was developed using the Secrete-Pair Gaussia Luciferase Assay Kit (Genecopoeia, Inc., Cat#LF061) and measured with the BioTek Synergy 2 luminescence plate reader.
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase activity was measured using the Luc-Pair Duo-Luciferase HT Assay kit (GeneCopoeia, Rockville, MD, USA) by adding luciferase substrates sequentially following manufacturer instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The 2x superhero PCR mix provided in the IndelCheck kit was used with primers purchased from GeneCopoeia specific to each target ...
-
bioRxiv - Cell Biology 2024Quote: ... and the luciferase reporter activity was determined using a Dual-luciferase assay kit (GeneCopoeia, Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... RNA levels were quantified using the Blaze Taq one-step SYBR Green RT-qPCR kit (GeneCopoeia, QP070) according to the manufacturer’s protocol and acquired on the ROCHE Lightcycler-96 system ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1 mL of MitoBeacon Red (GeneCopoeia, U.S.A.) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Syncytin-1 cDNA tagged with a V5 epitope sequence (#T0264; GeneCopoeia) was cloned into phCMV-EcoENV (Addgene #15802 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentiviral particle concentration was further determined by qPCR assessment of lentiviral RNA according to the manufacturer’s instructions (Lenti-Pac titration kit; LT005; GeneCopoeia).
-
bioRxiv - Cell Biology 2020Quote: ... lysed and analyzed for firefly and Renilla luciferase using Luc-Pair Duo-Luciferase HS Assay Kit expression as described in the manufacturer’s protocol (Genecopoeia).
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells stably expressing the chromatibody-GFP to visualize chromatin in living cells [30] were generated by TALEN insertion at AAVS1 site with co-transfection of SHDP-CMV-VHH-HA-GFP donor plasmid and AAVS1 right and left Talen plasmids (genome TALER AAVS1 safe harbor cloning kit, Genecopoeia) using TransIT-LT1 (MirusBio ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The total RNA was reverse-transcribed to cDNA using a high capacity cDNA Reverse Transcription Kit from GeneCopoeia (Maryland, USA). qRT-PCR was carried out to evaluate the syndecan-4 expression between lenti-synd4 shRNA and lenti-null group with SYBP Premix Ex Taq TM from Takara (Shiga ...
-
bioRxiv - Genomics 2021Quote: Lentivirus was produced in twelve 15cm dishes of 293T cells using Lenti-Pac HIV expression packaging kit following the manufacture’s protocol (GeneCopoeia, LT002). Lentivirus was filtered through a 0.45um PES filter system (Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The secondary fluorescent antibodies was Goat anti rabbit (1:1000, L114A, GeneCopoeia, United States). Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole ...
-
bioRxiv - Genomics 2020Quote: ... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
bioRxiv - Developmental Biology 2022Quote: ESCs were co-transfected with a plasmid expressing Cas9 protein and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing HA-FLAG-Pramel7WT and - PRAMEL7ΔN sequences under the CAG promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... Firefly and Renilla luciferase activities were measured using a Luc-Pair™ Duo-Luciferase HS Assay Kit (for high sensitivity) (GeneCopoeia). Firefly luciferase activity and Renilla luciferase activity were normalized ...