Labshake search
Citations for GeneCopoeia :
51 - 57 of 57 citations for 7 Methyl 1 5 dioxo 1 2 3 5 tetrahydro indolizine 6 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...