Labshake search
Citations for GeneCopoeia :
1 - 50 of 68 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated in 2 μg/mL 4′,6-diamidino-2-phenylindole (DAPI, GeneCopoeia, C002) in PBS for 5 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
bioRxiv - Microbiology 2023Quote: ... with an All-in-one 2×qPCR mix (GeneCopoeia) and primers specific for VACV genome ...
-
bioRxiv - Neuroscience 2022Quote: ... and Grp94 (MCP230394-CG12-3-B) were obtained from Genecopoeia (Rockville, MD). The DNA was amplified using standard molecular biology approaches ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then infected with SARS-CoV-2 Spike-Pseudotyped Lentivirus (Firefly Luciferase SARS-CoV-2 lentiviral particles-GeneCopoeia) and the control VSV-G protein pseudotyped Lentivirus (HLUC-Lv201 Firefly luciferase − eGFP lentifect-GeneCopoeia ...
-
bioRxiv - Microbiology 2023Quote: ... using All-in-oneTM 2× qPCR mix (GeneCopoeia) with specific VACV primers against the C11 gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and furin (DNA ratio 4:1) using polyethylenimine (PEI) or EndoFectinTM Max (GeneCopoeia). One-week post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with an all-in-one CRISPR/Cas9 plasmid for CLN5 (plasmid number HCP202087-CG01-1-B, Genecopoeia, Rockville, MD). 72 hours post-transfection ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2 pseudovirus assay was performed by Genecopoeia as previously described47 ...
-
bioRxiv - Cancer Biology 2021Quote: ... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... (catalogue number: HCP215394-CG04-3) and scrambled sgRNA control for pCRISPR-CG04 (catalogue number: CCPCTR01-CG04-B) were purchased from GeneCopoeia (Rockville, MD). The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells-Strain HB 101 (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A vector without cMYC 3’UTR (GeneCopoeia) was used as experimental control ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh-C (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-c); sh-E (5’-TAATACGACTCACTATAGGG-3’; HSH096566-LVRU6GP-e) or with the scrambled control (CSHCTR001-LVRU6GP, Genecopoeia), and the following packaging vectors ...
-
bioRxiv - Neuroscience 2021Quote: ... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FGFR1-3’UTR target plasmid (HmiT005432-MT06; GeneCopoeia) was co-transfected with 50 nM NCm or miR-22m into 293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Microbiology 2022Quote: ... Beta) and Brazil B.1.1.28.1/P.1 (EX-CoV245-M39-GS, Gamma) vectors were obtained from GeneCopoeia. The mutants N501Y ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Cancer Biology 2020Quote: The long and short 3’UTRs cloned into the dual-luciferase vector miTarget vector was obtained from GeneCopoeia. HCT116 cells were plated on 6-well plates and transfected with 50ng of each plasmid ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... NGN2_GFP (NEUROG2) lentivirus was transduced as previously described at MOI 3 (GeneCopoeia cat#LPP-T7381-Lv103-A00-S). At the one-week time point NGN2_GFP+/oTau - and NGN2_GFP-/oTau + asteroids were mixed and placed in 96-well culture as previously described ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Cell Biology 2020Quote: Cells were transfected with the firefly luciferase-expressing (pEZX-MT05) plasmids containing the 3′UTR of BIM or an empty vector (Genecopoeia) and were co-transfected with miR-24-3p mimic ...
-
bioRxiv - Molecular Biology 2023Quote: Full length wild Cacna2d2-3’UTR was cloned downstream of a Gaussia luciferase reporter gene in the pEZX-MT05 vector (GeneCopoeia). Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... C3H10T1/2 mesenchymal cells were transfected by the LUC-3’UTR without or with co-transfection of miR27a (MmiR3347-MR04-50, GeneCopoeia) using Lipofectamine 200 (Cat #11668027 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate stable HD-PTP knockdown cell lines we transduced SW1573 and H1299 cells with 3 individual HD-PTP shRNAs (LPP-HSH067569-LVRH1GH) and control lentiviral particles (Scramble, LPP-CSHCTR001-LVRH1GH) (GeneCopoeia). Cells were selected with hygromycin and the strongest HD-PTP shRNA knockdown was used for the remaining experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to perform in vitro miR-519a-3p target analysis on 3’UTR-PRNP reporter construct (vector pEZX-MT06, Genecopoeia). Cells were maintained in Advanced Dulbecco’s modified Eagle’s medium (AdDMEM ...
-
bioRxiv - Neuroscience 2020Quote: ... using All-in-One qPCR Mix (GeneCopoeia). Quantitative PCR consisted of 40 cycles ...
-
bioRxiv - Genetics 2021Quote: ... reverse transcription and real time RT-qPCR analysis were carried out using the ALL-in-ONE First-Strand cDNA Synthesis Kit and All-in-One qPCR Mix (GeneCopoeia) and the SsoFast EvaGreen Supermix according to the manufacturer’s protocols on CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... One plasmid on the pCRISPR-CG01 backbone (GeneCopoeia) codes for recombinant Cas9 and a sgRNA (5’-GCCAAACATAAGTGACCAAC-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNAs were subjected to real-time qPCR in a Step-One Plus system (Applied Biosystem) using The All-in-One qPCR Mix (GeneCopoeia, #QP001-01). Sequences of oligonucleotides used are ...
-
bioRxiv - Neuroscience 2020Quote: ... The All-in-One qPCR Mix (GeneCopoeia, #QP001-01) was used to perform RT-qPCR ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral shRNA against HCAR1 targeting 3’UTR regions of the gene (shHCAR1a: GCTTTATTTCAGGCCGAATGA; shHCAR1b: GCTCTGACCTTCTTCAAATCT) and the scrambled shRNA were purchased from GeneCopoeia (Cat# LPP-HSH007585-LVRU6MP-100). Targeting the 3’UTR regions allowed us to use our previous plasmid constructs for rescue experiments.
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was performed using All-in-one qPCR Mix (GeneCopoeia, QP005) with primers specific for E3L ...
-
bioRxiv - Microbiology 2021Quote: An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD) was used for milRNA expression analysis [12] ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed with 2X All-in-One qPCR Mix (Genecopoeia Catalog#: QP001) using the following reaction mix ...
-
bioRxiv - Neuroscience 2022Quote: 1,5μl of a viral mix (1:1) of AAV9:CMV-miR-124-mCherry (titer: ≥5×1012 GC/ml, GeneCopoeia) and AAV5:GFAP-Cre (titer:≥7×10¹² GC/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... and PRG4-gLuc (9,394 Bp, Genecopoeia, Fig. 1) were purified from transformed competent E ...
-
bioRxiv - Cancer Biology 2020Quote: All-in-one CRISPR-Cas9 clones targeting Snord67 were purchased from Genecopoeia (vector pCRISPR-CG02). sgRNA sequences were designed with help from CRISPOR (51 ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Cell Biology 2021Quote: ... pCRISPR-CG01 (HCP216100-CG01-1-10) was purchased from GeneCopoeia and pcDNA3-Flag-mTOR wt (ID-26603 ...
-
bioRxiv - Physiology 2023Quote: Huh-7 or AML12 cells (2.5 x 105) were reverse transfected in triplicate in 6 well plates using Endofectin (Genecopoeia) with the indicated doses of miRIDIAN miRNA mimics (miR-541-3p) ...
-
bioRxiv - Cancer Biology 2020Quote: ... all-in-one CRISPR plasmids with mCherry reporter were purchased from Genecopoeia (Cat # HCP218175-CG01, HCP216131-CG01).Cells were transfected with CRISPR plasmids ...