Labshake search
Citations for GeneCopoeia :
51 - 67 of 67 citations for Recombinant Human Carboxylesterase 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Human cDNA CD133 expression plasmid (EX-Z0396-M02) and empty vector plasmid (EX-NEG-M02) were obtained from GeneCopoeia. MIA PaCa-2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used to generate CEACAM6 knock-out cells (A549-CEACAM6-KO) using lentivirus particles carrying the CRISPR human sgRNA for CEACAM6 (Genecopoeia). Clones were selected using puromycin and the CEACAM6-expression knockout was confirmed by flow cytometry and Western blot.
-
bioRxiv - Cancer Biology 2022Quote: Overexpression of human MDK was performed using the ORF lentiviral expression vector pReceiver-Lv105-A0792 (MDK) and the corresponding empty vector (Genecopoeia. MDK silencing was performed by lentiviral-driven expression of shRNAs ...
-
bioRxiv - Biochemistry 2019Quote: ... U87MG cells stably expressing C-terminal 3x FLAG tagged DDX28 were generated by transfecting cells with the OmicsLink™ pEZ-M14 EX-A3144-M14 expression vector encoding the human DDX28 coding sequence (Genecopoeia). Selection was initiated 48 h post-transfection using 1 μg/mL puromycin or 400 μg/mL G418 ...
-
bioRxiv - Neuroscience 2022Quote: ... A human JUN expression vector under the CMV promoter in pEZ-MO2 was purchased from GeneCopoeia (Cat. No.: EX-B0091-M02). For siRNA transfections ...
-
bioRxiv - Genetics 2022Quote: 3x Flag- and GFP-tagged expression plasmids were used to express human CIDEC wild type (WT) and the CIDEC rare variants (E186X, V47I, Y61H, V161M, or Q220H) (Genecopoeia, Inc.). GFP-and mCherry-tagged plasmids were used to express human PLIN1 ...
-
bioRxiv - Physiology 2019Quote: ... COS-7 cells were transfected with 5 μg of plasmid expressing human ApoB48 cDNA under the control of CMV promoter using endofectin (Genecopoeia, EF014) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... a solution was prepared by adding 2 drops of EasyProbe-Hoechst 33342 Live Cell Stain (GeneCopoeia) into 1 ml of M9 buffer ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Biochemistry 2023Quote: Lenti-SARS-CoV-2 Full Length Spike protein-pseudotyped (WT) and ACE2+ 293 cell lines were purchased from Genecopoeia. Viruses were produced as recommended by the manufacturer and harbored a luciferase expressing plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were introduced at 2 ng/μl of each (emerin shRNA, HSH095287-LVRU6MH; shRNA scramble sequence, CSHCTR001-LVRU6MH; Genecopoeia). For both methods ...
-
bioRxiv - Molecular Biology 2020Quote: ... we targeted exon 2 of NSUN6 with wild type Cas9 (pSpCAs9(BB)2A-GFP) plus the recombination vector pD07 (Genecopoeia) carrying the selection genes puromycin and eGFP under control of EIF1a promoter and with homology arms on Introns 1 and 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...