Labshake search
Citations for GeneCopoeia :
51 - 100 of 120 citations for Human PLA2G4F shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... a control luciferase reporter plasmid (CmiT000001-MT06; GeneCopoeia, Rockville, USA) or FGFR1-3’UTR target plasmid (HmiT005432-MT06 ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: ... a pReceiver-Lv205-based expression plasmid (Genecopoeia, Rockville, MD, USA) was modified stepwise to harbor a pQCXIP-based expression cassette ...
-
bioRxiv - Cell Biology 2022Quote: ... Custom ordered COL2A1-Gaussia Luciferase plasmid (HPRM22364-LvPG02, GeneCopoeia, Inc.), envelope (pMD2.G ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FLAG-tagged human RIOK1 were obtained from Genecopoeia (Rockville, MD). The RIOK1 Ser22 to Ala mutant and Ser21/22 to Ala double mutant were generated using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: Human FOXN1 cDNA was purchased from Genecopoeia (sequence accession number BC140423). Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... or containing the cDNA for human MGP (EX-Z9471-Lv122; GeneCopoeia), and the following packaging vectors ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: Construct containing full-length human TOP2A cDNA sequence were purchased from Genecopoeia. Site-directed mutagenesis were conducted using QuikChange Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Cell Biology 2020Quote: CPT1A plasmid with neomycin selection marker (A1436) was purchased from GeneCopoeia. Plasmid transfections were performed with Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-Cas9 knockout plasmids were obtained from Genecopoeia (Rockville, MD, USA) and overexpression plasmids were obtained from GenScript (Piscataway ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid DNA (15 µg) and 50 µL of Endofectin Max (Genecopoeia) were each diluted to 750 µL with Opti-MEM™ in separate tubes ...
-
bioRxiv - Bioengineering 2022Quote: Lubricin promoter-driven Gaussia luciferase (Gluc) plasmid map (9,394 Bp, Genecopoeia). Contains puromycin (Puro ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of plasmids and 5 μL of EndoFectin (GeneCopoeia, EF014) were mixed with 125 μL of Opti-MEM reduced serum media (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Hif1a promoter reporter plasmids expressing Gaussia luciferase were acquired from GeneCopoeia. To evaluate Ndufa4l2 promoter activity cells were stimulated with vehicle ...
-
bioRxiv - Molecular Biology 2024Quote: ... or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC, GeneCopoeia) and 100nM of either miRIDIAN miRNA mimic of mmu-miR-532 (C-310769-01-0002 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the pReceiver-Lv165 empty vector plasmid (EX-NEG-Lv165, GeneCopoeia) contain an EEF1A promoter with an IRES2 followed by an eGFP fluorescent marker ...
-
bioRxiv - Biophysics 2021Quote: ... The cDNA encoding human spastin (NM_014946.3) was purchased from GeneCopoeia (product ID: U1177) and was subcloned into a modified pET vector containing N-terminal 6xHis and MBP tags ...
-
bioRxiv - Cancer Biology 2020Quote: ... USA) and guide RNA plasmids were obtained from Genecopoeia (Rockville, MD, USA). The transfected 293T cells were maintained in culture for 48-72 hours ...
-
bioRxiv - Biophysics 2019Quote: ... The plasmid of GFP-fused CD98 heavy chain was purchased from GeneCopoeia™ (EX-G00009-M98) ...
-
bioRxiv - Cell Biology 2020Quote: ... Most of the lysosomal membrane protein overexpression plasmids were purchased from GeneCopoeia. The CDS of RNF152 was purchased from Horizon Discovery ...
-
bioRxiv - Neuroscience 2021Quote: ... a commercial plasmid encoding full-length mouse LAG3 CDS (GeneCopoeia, Mm0357-02) was used as standard ...
-
bioRxiv - Cell Biology 2023Quote: ... Fbh1 and Rad51 expression plasmids were obtained from GeneCopoeia (#EX-E2953-Lv105) and Addgene (CMV-hRad51 ...
-
bioRxiv - Neuroscience 2021Quote: ... human or mouse LAG3 cDNA sequence (GeneCopoeia #EX-Z5714-M02 and #EX-Mm03576-M02) were inserted into an autoregulatory ...
-
bioRxiv - Molecular Biology 2023Quote: ... CopGFP and shBAZ2A for human BAZ2A were cloned into DC-DON-SH01 vector (GeneCopoeia). Site-directed mutagenesis was performed to create BAZ2A mutants WY531/532GA (H/F-BAZ2AWY/GA ...
-
bioRxiv - Cell Biology 2023Quote: ... Amplified vector DNA (Cloned 3’UTR human Angptl4 (Endofectin GeneCopoeia catalog no. EF013-S) and miRNA 3’UTR (MmiT088761-MT06-264ng/ul ...
-
bioRxiv - Microbiology 2021Quote: ... were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM_021804) ...
-
bioRxiv - Cell Biology 2022Quote: The sequence of human SPG11 was cloned into a pReceiver-M12 Expression Clone vector (GeneCopoeia). 3xFlag-GFP was used as a negative control in pull-down experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... and C-terminal MYC tag was placed in front of human NPHP3 (GeneCopoeia GC-H2370). All mutations to replace the lipidated cysteine with alanine were made using PCR mutagenesis (Weiner et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: Human embryonic kidney 293Ta (HEK293Ta) and HEK293T Lenti-X cells were purchased from GeneCopoeia (#LT008) and Takara (#632180) ...
-
bioRxiv - Cell Biology 2024Quote: The plasmids encoding FOXO1 (EX-Z7404-M02) were constructed by GeneCopoeia (Rockville, MD, USA). The hCMEC/D3 cells were plated in plates or dishes at 6 × 104 cells/cm2 ...
-
bioRxiv - Genetics 2019Quote: Tagged human wild-type mRNAs cloned into a CMV promoted expression vector were obtained from GeneCopoeia. The ORFs of AFF3 and AFF4 were inserted in pEZ-M13 vector with a C-terminal FLAG tag ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmids used were mouse full length GSAP with HA tag (EX-Mm30424-M07, Genecopoeia), human GSAP-16k with HA tag (a.a ...
-
bioRxiv - Cell Biology 2022Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and silica column purified (Qiagen Maxiprep ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... envelope (pMD2.G) and packaging (psPAX2) plasmids were amplified in Escherichia coli (GCI-L3, GeneCopoeia) and purified via silica column (Qiagen Maxiprep ...
-
bioRxiv - Genetics 2019Quote: ... A pDONR entry clone containing the human rhodopsin cDNA sequence was purchased (GeneCopoeia #GC-T1321, Rockville, MD). Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were infected with 1 × 106 TERT Human Lentifect Purified Lentiviral Particles (GeneCopoeia, LPP-Q0450-Lv05-200-S). To aid in infection ...
-
bioRxiv - Bioengineering 2020Quote: ... Viruses were produced in HEK-293Ta cells using human lentiviral packaging system according to the manufacturer’s instructions (Genecopoeia). Puromycin was used to select only for transduced cells ...
-
bioRxiv - Biophysics 2021Quote: The cDNA encoding human SSNA1 (NM_003731.2) with an N-terminal 6xHis-tag in a pReceiver-B01 vector was purchased from GeneCopoeia, Rockville ...
-
bioRxiv - Bioengineering 2020Quote: Lentifect™ custom lentivirus encoding for MDR1 (human ABCB1, transcript variant 3, accession version: NM_000927.4) and a puromycin-resistant gene was prepared by Genecopoeia. Transduction was performed according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cotransfected with human PRNP 3’UTR miRNA Target Clone (pEZX-3’UTR-PRNP vector from Genecopoeia) and hsa-miR-519a-3p miRCURY LNA miRNA Mimic or its related Negative Control miRCURY LNA miRNA Mimic (Qiagen) ...
-
bioRxiv - Developmental Biology 2023Quote: The open reading frame encoding human FZD2 sequence was purchased from GeneCopoeia (Rockville, MD, clone #GC-S0193-B). Restriction-free cloning was used to add a C-terminal Flag-tag (DYKDDDDK ...
-
bioRxiv - Cancer Biology 2020Quote: ... all-in-one CRISPR plasmids with mCherry reporter were purchased from Genecopoeia (Cat # HCP218175-CG01, HCP216131-CG01).Cells were transfected with CRISPR plasmids ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVECs were transfected with 1μg of pcDNA3 plasmid vector containing a full-length mouse Vegfr3 cDNA (GeneCopoeia), or with empty vector (Martucciello et al. ...
-
bioRxiv - Bioengineering 2020Quote: ... Human lung squamous cell carcinoma dual-labeled (eGFP, Luciferase) stable NCI-H1299 (SCL-C01-HLG; Genecopoeia, Inc, Rockville, MD) cells were grown in RPMI-1640 containing 10% fetal bovine serum without antibiotics at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2019Quote: HEK-293T cells were transfected with a transfer plasmid (pReceiver-Lv215) containing ZEB1 cDNA of transcript variant 2 (NM_030751.5) (GeneCopoeia) and a 3rd-generation packaging system ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid DNA was extracted from a miRNA 3’UTR target clone for ALK1 (HmiT022834-MT06, GeneCopoeia, MD, USA) using Qiagen Plasmid Midi Kit (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... containing an sgRNA targeting TCGACAGCCTTATGGCGGAC in the mouse PFN1 gene and the puromycin donor plasmid pDonor-D01 (Genecopoeia) for selection ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were co-transfected with 100ng of murine Gria1 3’ UTR renilla/luciferase plasmid (MmiT076857-MT06-GC, GeneCopoeia) or miRNA 3’ UTR target control plasmid (CmiT000001-MT06-GC ...
-
bioRxiv - Microbiology 2021Quote: ... 1): AGM Vero E6 cells were transduced with the newly generated Vervet sgRNA library and human HEK293T-hACE2 cells (Genecopoeia) were transduced with the Brunello sgRNA library ...
-
bioRxiv - Cell Biology 2022Quote: The expression construct for full-length human CEMIP (Uniprot ID: Q8WUJ3) containing a FLAG tag at the C-terminus in pReceiver-M39 was purchased from GeneCopoeia. HEK293 expressing the SV40 large T antigen were cultured in DMEM/F12 with 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CHO cells stably expressing cloned CB2 (CB2-CHO) were produced by electroporation with the human CB2 N-3xHA tag cDNA (GeneCopoeia). A stable expressing population was selected for with 500 μg/mL G418 ...