Labshake search
Citations for Epoch Life Science :
1 - 50 of 71 citations for WAS Protein Family Member 3 WASF3 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
bioRxiv - Biochemistry 2022Quote: The following Dynactin coding genes were codon-optimized for protein expression in insect cells and synthesized (Epoch Life Science): DCTN1 (Protein name p150 ...
-
bioRxiv - Synthetic Biology 2021Quote: The DNAs encoding the protein motifs used in this study were mammalian-codon optimized and synthesized by Epoch Life Science and then cloned into mammalian expression backbones ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli codon-optimised genes encoding each full-length protein and isoform 2 of CPSF30 (Uniprot O95639-2) in pACEBac vectors were synthesized by Epoch Life Science. All cloning was validated by sequencing (Source Bioscience).
-
bioRxiv - Cell Biology 2019Quote: ... ARFGEF3 was custom synthesized (Epoch Life Sciences) and cloned between KpnI and NotI into pcDNA3.1+ ...
-
bioRxiv - Neuroscience 2023Quote: ... Engineering was undertaken by Epoch Life Science and/ or the McCrea laboratory ...
-
bioRxiv - Cancer Biology 2023Quote: ... was recloned in a pDONR221 backbone and the Myc-tag was replaced with a Flag-tag (Epoch Life Science). The sequence 5’-CAATGCGGAATATCAATCCCAGCACAGCAAATTCTCCA AAATGTCAGG-3’ was added between base pairs 982 and 983 of the YAP1 gene ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... multiplicata AHR was synthesized by Epoch Life Sciences, Inc ...
-
bioRxiv - Microbiology 2022Quote: ... pZA21-6xms2 was synthesized by Epoch Life Science, USA ...
-
bioRxiv - Biophysics 2023Quote: ... This construct was assembled by Epoch Life Sciences Inc ...
-
bioRxiv - Biophysics 2023Quote: ... This construct was assembled by Epoch Life Sciences Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... The left homology arm was generated by PCR and the right homology arm was synthesized by Epoch Life Science (Sugarland, TX, USA). The donor plasmid and guide RNA containing pCFD4 plasmid was co-injected into Act5C-Cas9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the plasmid DNA was purified (Epoch Life Science). All genetic part sequences and plasmids used in this work are in Table S1 and S11 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... library DNA was harvested via miniprep (Epoch Life Science) on all transformed and plated cells ...
-
bioRxiv - Bioengineering 2021Quote: ... The PCR product was agarose gel purified (Epoch Life Science) then deep sequenced via Illumina HiSeq 2500 with a high output 8-lane flow cell with v4 chemistry at the University of Minnesota Genomics Center.
-
bioRxiv - Cell Biology 2022Quote: ... RNA was purified using Econo Spin columns (Epoch Life Sciences). RNA-sequencing was performed according to manufacturer’s instructions (TruSeq 2 ...
-
bioRxiv - Synthetic Biology 2021Quote: Plasmid DNA was prepared using the Econospin columns (Epoch Life Science) according to manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmid DNA was isolated using mini plasmid preparation (Epoch Life Science). Analytical digests with MluI/BspEI were performed and run on gel electrophoresis to assay if a correct product was made ...
-
bioRxiv - Microbiology 2019Quote: ... Poly-P was isolated using EconoSpin silica spin columns (Epoch Life Science) and digested with 1µg of PPX1 exopolyphosphatase from Saccharomyces cerevisiae ...
-
bioRxiv - Molecular Biology 2019Quote: ... and an entire volume was transferred to Econospin column (Epoch Life Science) for binding DNA to the membrane ...
-
bioRxiv - Neuroscience 2019Quote: ... The CoChR-mTagBFP2-Kv2.2motif-ER2 gene was assembled by Epoch Life Science Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... The Donor DNA sequence was synthesized by Epoch Life Science (http://www.epochlifescience.com) and cloned into a PBSK plasmid backbone.
-
bioRxiv - Microbiology 2020Quote: ... The Chikungunya Full PS mutant was custom synthesized (Epoch Life Science, Inc) and subcloned by restriction digest into the pSinRep5-181/25 Chikungunya infectious clone (kindly provided by Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid DNA was miniprepped (Econospin 96-well filter plate, Epoch Life Science) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: GCaMP6s was generated by a custom gene synthesis service (Epoch Life Science) and subcloned into a pLV-CMV-PGK-Hyg lentiviral vector (Cellomics Technology ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA from 400 μL of suspension was extracted via miniprep (Epoch Life Science). Three replicates were performed on three different days.
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was transferred to mini spin DNA purification columns (Epoch Life Science). 500 uL PB and 750uL PE buffer (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid DNA was extracted using a mini plasmid preparation kit (Epoch Life Science). Analytical digests with MluI ...
-
bioRxiv - Bioengineering 2021Quote: ... DNA was extracted from 600 μL of each suspension via miniprep (Epoch Life Science). Three replicates were performed on three different days.
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmid DNA was isolated using a mini-prep kit (Epoch Life Science, 2160250). The DNA sequence was analyzed using a primer that binds upstream of the T7Max promoter and confirmed the transition into ORF.
-
bioRxiv - Microbiology 2023Quote: ... and RNA was extracted with GenCatch™ Total RNA Miniprep Kit (Epoch Life Sciences) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... DNA was extracted using the GenCatchPCR Purification kit (Epoch Life Science, Misouri City, TX) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA was extracted from 1 mL of suspended culture via miniprep (Epoch Life Science). The transformation yielded approximately 21 million colonies ...
-
bioRxiv - Immunology 2022Quote: ... total RNA was isolated from the aqueous phase using Econo-spin columns (Epoch Life Science) and subjected to on-column PureLink DNase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... pCMV-p35 was cloned into pDONR221 Gateway entry vector (Epoch Life Science; Sugar Land, TX) and packaged into a herpes simplex virus 1 (HSV-1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The amplified oligo pool was then purified using GenCatchTM PCR Cleanup Kit (Epoch Life Science) and eluted in Tris buffer (pH = 8).
-
bioRxiv - Microbiology 2023Quote: ... Half of each sample was incubated with 100 ug/mL Proteinase K (Epoch Life Science) at pH 8.0 at 37°C for 30 mins ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant transfer vector p72mCheryΔI177L was obtained by DNA synthesis (Epoch Life Sciences Missouri City, TX, USA).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using the GenCatch genomic DNA extraction kit (Epoch Life Science, Sugar Land, TX) following the manufacturer’s protocol for tissue samples ...
-
bioRxiv - Zoology 2023Quote: ... Microbial DNA was extracted using the GenCatch™ Plasmid DNA Mini-Prep Kit (Epoch Life Science) following manufacturer instructions with minor modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extract was loaded onto three EconoSpin columns for RNA (Epoch Life Science; cat. 1940-250) and each column washed once with 600 µL WB1A (3 M guanidine thiocynate ...
-
bioRxiv - Microbiology 2021Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). PCR for the detection of the full-length ORF50 gene was performed using primers ORF50_del_for 5’GCTTCCTCGTCTACAGAGGTCAGG and ORF50_del_rev 5’GGCACCCATACTAAGTTGTGATTC ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNA was purified using GenCatch Advance Gel Extraction Kit (Epoch Life Sciences; Missouri City, TX, USA). Purified DNA was sequenced using Sanger sequencing (Genewiz ...
-
bioRxiv - Immunology 2020Quote: ... and the solution was transferred to a silica column (Epoch Life Science, Inc., Sugar Land, TX, USA) and centrifuged ...
-
bioRxiv - Plant Biology 2023Quote: ... and RNA was extracted as described (Yaffe et al., 2012) using EconoSpin plate columns (Epoch Life Science). mRNA libraries were prepared following an in-house protocol (rCambiagno et al. ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated with the GenCatch Plus Genomic DNA Miniprep Kit (Epoch Life Science, Missouri City, TX) or with the DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was isolated using a GenCatch blood and tissue genomic mini-prep kit (Epoch Life Science). A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega ...
-
bioRxiv - Neuroscience 2019Quote: ... The pAAV-Syn-Archon1-KGC-EGFP-Kv2.1motif-P2A-CoChR-Kv2.1motif plasmid was also cloned by Epoch Life Science Inc ...
-
bioRxiv - Genetics 2020Quote: ... 600 μL of clear lysate was transferred to DNA binding plates (Epoch Life Sciences EconoSpin™ 96 well) stacked over a 1 mL collection plate and centrifuged 5 minutes (RT ...