Labshake search
Citations for Nzytech :
1 - 50 of 96 citations for hsa mir 146a Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Retro-transcription into cDNA was performed using a RT-PCR kit NZY First-Strand cDNA Synthesis Kit # MB12501 (NZYtech). Quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Retro-transcription into cDNA was performed using a RT-PCR kit NZY First-Strand cDNA Synthesis Kit # MB12501 (NZYtech).
-
bioRxiv - Molecular Biology 2024Quote: ... Reverse Transcriptase quantitative PCR (RT-qPCR) was performed using NZYSpeedy qPCR Green Master Mix ROX (#MB22302, NZYTech) or NZYSpeedy qPCR Green Master Mix ROX Plus (#MB22202 ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription (RT) was performed using the NZY first strand cDNA synthesis kit (NZYTech, MB12502). Real-time RT-PCR was prepared in 384-well ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription (RT) was performed using the NZY MuLV first strand cDNA synthesis kit (NZYTech, MB17302). Real-time RT-PCR to detect GAPDH ...
-
bioRxiv - Microbiology 2021Quote: The PCR products were purified by using NZYGelpure kit (Nzytech) and sequenced upstream and downstream ...
-
bioRxiv - Neuroscience 2024Quote: ... from 10 ng of RNA was performed using the One-step NZYTECH RT-qPCR Green kit according to manufactureŕs protocol (NZYTECH, MB34302). RT-PCR was normalized using the housekeeping genes hypoxanthine phosphoribosyl-transferase 1 (HPRT1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Both PCR products (DNA or cDNA) were cleaned using the NZYGelpure kit (#MB01102, NzyTech) and sent for Sanger sequencing to STABVIDA with data visualized and analyzed using Chromas v2.6.2 software.
-
bioRxiv - Evolutionary Biology 2024Quote: Samples from four equidistant time series of each evolutionary lineage were collected to extract RNA using the NZY Viral RNA Isolation kit (NZYTech) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... before detection with NZY ECL Supreme HRP substrate (NZYtech, Lisboa, Portugal).
-
bioRxiv - Developmental Biology 2022Quote: ... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... For cloning the amplified fragments we used the NZY-A PCR cloning kit and NZYStar Competent Cells (refs. MB053 and MB00501 NZYTech, Portugal). Inserts contained in recombinant plasmids were sequenced as described above using plasmid based primers T7 (TAATACGACTCACTATAGGG ...
-
bioRxiv - Microbiology 2023Quote: ... The antibiotic resistance cassette together with genome flanking regions (∼600 bp) were amplified and PCR products were purified using the NZYGelpure kit (NZYTech, Lisbon, Portugal). These PCR fragments were transformed into B ...
-
bioRxiv - Developmental Biology 2023Quote: ... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR with the NZYTaq II 2x Green Master Mix (Nzytech) was performed on cDNA from three biological replicates of germinating seeds (18 hours after stratification ...
-
bioRxiv - Genetics 2020Quote: ... Edited founders were identified by PCR amplification (Taq polymerase, NZYtech) with primers flanking the edited region (see Table S8 for primer sequences) ...
-
bioRxiv - Bioengineering 2022Quote: ... Colony PCR with NZYTaq II 2x Green Master Mix (Nzytech) or DreamTaq 2x Green PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR with the NZYTaq II 2x Green Master Mix (NZYtech) was performed on cDNA from 3-4 biological replicates of germinated seeds (44 h after stratification ...
-
Spatial and long-term temporal evolution of a marine mussel hybrid zone (Mytilus spp.) in SW EnglandbioRxiv - Evolutionary Biology 2023Quote: ... PCR products together with the NZYDNA ladder V (NZYtech, Lisbon, Portugal) were separated in 2% agarose gels supplemented with 2.5 µL of SYBR Safe dye at 90 volts for 40 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was performed using NZYTaq II 2x Green Master Mix solution (NZYTech, Portugal). DNA concentration was measured with NanoVue spectrophotometer (GE Healthcare ...
-
bioRxiv - Genomics 2023Quote: ... For 13 kb SCN10A PCR we used Supreme NZYLong DNA Polymerase (Cat. #MB331, NZYTech®) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2020Quote: ... purified with NZYGelpure kit (NZYTech) and cloned into the entry vector pCR®8/GW/TOPO (#250020 Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... ROX plus kit (NZYtech, Portugal) and the 7500 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified by PCR (Accuzyme DNA Polymerase, Bioline, or Supreme NZYProof DNA Polymerase, Nzytech) with specific oligonucleotides (listed in Table S4 ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative PCR was performed in a 96-well optical plate using SYBR green master mix (NZYtech). PCR and data acquisition was performed using the AB7300 Real-Time PCR thermal cycler with Step One software (v2.2.2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was analysed by electrophoresis on a 2% agarose gel stained with Green Safe Premium (NZYTech).
-
bioRxiv - Microbiology 2020Quote: ... purified using the NZYGelpure kit (NZYTECH), and directly sequenced using the ABI Prism BigDye Terminator v3.1 Cycle sequencing kit on a 3130 Genetic Analyser (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified using the NZYGelpure kit (NZYTech) following manufacturers’ instructions and quantified with a NanoDrop spectrophotometer.
-
bioRxiv - Cancer Biology 2022Quote: ... purified using the NZYGelpure kit (NZYTech) following manufacturers’ instructions and quantified with a NanoDrop spectrophotometer ...
-
bioRxiv - Pathology 2023Quote: ... purified using the NZYGelpure kit (NZYTech) following manufacturers’ instructions and quantified with a NanoDrop spectrophotometer ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids were extracted with NZYMiniprep kit (NZYTech) and confirmed by Sanger sequencing ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... or NZY Total RNA isolation kit (NZYtech), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: First-strand cDNA was synthesized from total RNA using a cDNA synthesis kit (NZY First-Strand cDNA Synthesis Kit, (NZYTech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out using primers listed in Supplementary Table 1 (relate to all figures) and Taq polymerase (NZYTech).
-
bioRxiv - Cell Biology 2021Quote: ... DNA amplification was performed with 50 ng of genomic DNA from each individual by Polymerase Chain Reaction (PCR) using the NZYtaq II Green Master Mix (NZYtech). The primers used for each of the EDN-1 gene regions are described in Supp ...
-
bioRxiv - Immunology 2021Quote: ... Products derived from PCR were visualized on a 2% agarose/TBE gel with GreenSafe premium nucleic acid stain (NZYTech, Portugal). For primary diagnostics ...
-
bioRxiv - Biochemistry 2021Quote: ... or NZY Plant/Fungi gDNA Isolation kit (Nzytech), according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The Transcriptor First Strand cDNA Synthesis Kit (Nzytech) was used to reverse transcribe 1 μg of extracted RNA and the generated cDNA volume (20 μl ...
-
bioRxiv - Genomics 2023Quote: ... Plasmids were purified with NZYMiniprep kit (#MB010, NZYTech) and validated using Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “NZY tissue gDNA isolation kit” (NZYtech, Portugal) was used ...
-
bioRxiv - Biochemistry 2021Quote: ... or the NZY Plant/Fungi gDNA Isolation kit (NZYTech). The latter included a homogenization step (grinding cells using a mortar and pestle with liquid nitrogen ...
-
bioRxiv - Microbiology 2023Quote: The plasmids were extracted using a miniprep kit (NZYTech), the constructs were confirmed by Sanger sequencing (STAB VIDA ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-directed mutagenesis was performed using the NZYMutagenesis kit (NZYTech), to mutate four hZαβDAI residues known to be critical for nucleic acid binding to Ala (Zαβ-N46A/Y50A and Zαβ-N141A/Y145A) ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were purified using the NZYMiniprep kit (NZYTech, ref. MB01001).
-
bioRxiv - Plant Biology 2023Quote: Total RNAs were extracted with RNA isolation kits (NZYtech, Portugal). The RNA quality and concentration were assessed prior to cDNA synthesis ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was isolated using NZY Total RNA Isolation kit (NZYtech). RNA library preparation and transcriptome sequencing were conducted by Novogene Co. ...
-
bioRxiv - Cell Biology 2022Quote: ... and a miniprep was performed to extract the DNA (NZYTech kit). The plasmid pET28a and mCherry purified PCR product were enzymatically hydrolysed with NdeI and BamHI-HF restriction enzymes followed ...
-
bioRxiv - Cell Biology 2021Quote: RNA extraction was carried out using NZY Total RNA Isolation Kit (NZYtech) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: RNAs were extracted using the NZY Total RNA Isolation Kit (NZYTech, MB13402). 0.5 μg of purified RNA samples were used for first strand cDNA synthesis (NZYTech ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids were extracted from white colonies using the NZYTech Miniprep Kit (NZYTech), and were prepared for sequencing using the primers 27F (Neilan et al. ...