Labshake search
Citations for Nzytech :
1 - 50 of 52 citations for Dengue Virus Serotype 1 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were produced as periplasmic components in 1 L of the NZY Auto-Induction TB medium (NZytech) according to the manufacturer’s recommendations and were purified by immobilized metal affinity chromatography on a HiTrap TALON® crude 1 mL column (Cytiva) ...
-
bioRxiv - Molecular Biology 2022Quote: NZYBlue Protein Marker (NZYtech) was used for protein size estimation and protein concentrations were measured with QUBIT® 2.0 (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... Gels containing total protein fractions and insoluble protein fractions were stained with blue safe (NZYTech, Cat.MB15201) for 30 minutes and revealed with the Odyssey Infrared Imaging system (Li-cor Biosciences).
-
bioRxiv - Cell Biology 2019Quote: ... using NZYColour Protein Marker II (NZYTech). Blotting was performed with an iBlot Gel Transfer System (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were stained with BlueSafe solution (NZYtech). Western blotting on SDS gels was performed with an Invitrogen iBlot2 device and fitting iBlot2 NC stacks (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... NZYColour Protein Marker II (NZYTech, Lisbon, Portugal) was used as a protein molecular weight marker ...
-
bioRxiv - Biochemistry 2023Quote: ... was stained with BlueSafe protein stain (NZYTech).
-
bioRxiv - Microbiology 2019Quote: ... Molecular weights were estimated using a calibration curve (Log10 MW vs Rf) constructed with a prestained protein standard (NZY Colour Protein Marker II, Nzytech, Portugal).
-
bioRxiv - Biophysics 2022Quote: ... Protein expression was induced with 1mM of IPTG (Nzytech) and performed for 5 h at 28ºC ...
-
bioRxiv - Systems Biology 2023Quote: ... Protein samples diluted in 5x SDS sample buffer (NZYTech) were denatured at 95º for 10 min and resolved in an 8% polyacrylamide gel (SDS-PAGE) ...
-
bioRxiv - Biochemistry 2023Quote: ... and visualized by BlueSafe protein stain (NZYTech, ref. MB15201). To further characterize the oligomeric content of TTR1st ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein molecular weight marker was NZYColour Marker II (NZYTech, Portugal) or Precision Plus Protein WesternC Standards (Bio-Rad ...
-
bioRxiv - Molecular Biology 2019Quote: Protein lysates mixed with 1x SDS-PAGE Sample Loading Buffer (NZYtech) were denatured at 95°C for 10 minutes and centrifuged at 500g for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... mk+) supE44 thi-1 recA1 gyrA96 relA1 lac[F′ proA+B+ lacIq ΔlacZM15:Tn10(TcR)]) chemically competent cells (NZYtech) were used as an intermediate host for cloning purposes and they were grow in LB medium at 37 °C under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... the quality and purity of protein batches was assessed by BlueSafe (NZYTech, Lisbon) staining after electrophoresis in SDS-PAGE gels ...
-
bioRxiv - Biochemistry 2021Quote: ... the quality and purity of protein batches was assessed by BlueSafe (NZYTech, Lisbon) staining after electrophoresis in SDS-PAGE gels ...
-
bioRxiv - Biochemistry 2020Quote: ... the quality and purity of protein batches was assessed by BlueSafe (NZYTech, Lisbon) staining after electrophoresis in SDS-PAGE gels ...
-
bioRxiv - Neuroscience 2022Quote: ... Full-length blots with the molecular weight standards (NZYColour Protein Marker I, NZYTech) are provided in Supplementary Figures 5 and 6.
-
bioRxiv - Cell Biology 2020Quote: ... Reduction of protein disulfide bonds was carried out with 10 mM dithiothreitol (DTT, Nzytech MB03101) in 100 mM NH4HCO3 and subsequent alkylation was performed with 55 mM iodoacetamide (IAA Sigma I1149-25G) ...
-
bioRxiv - Biophysics 2020Quote: ... coli cells (NZYTech) grown in LB medium ...
-
bioRxiv - Cell Biology 2024Quote: ... for 5 min at 95°C in the presence of 50 mM DTT and protein standard (NZYTech, MB09002) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... The rest of the plasmids encoding Vav1 mutant proteins were generated in this work by site-directed mutagenesis using the high-fidelity NZYProof DNA polymerase (Cat. #14601, NZYTech) and the appropriate combination of mutation-bearing oligonucleotides (Table S1).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were lysed with NZYol (NZYtech) and RNA extracted using a standard protocol with chloroform-isopropanol-ethanol.
-
bioRxiv - Developmental Biology 2023Quote: RNA from FAC-Sorted EdU+ cells (neural cells >650,000) was isolated by NZY Total RNA Isolation kit (NZYTech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21(DE3) Gold competent cells (Nzytech). 300 mL of Luria Bertani medium containing 50 μg/mL kanamycin was inoculated with a single colony of E ...
-
bioRxiv - Cell Biology 2021Quote: ... and used to transform NZYstar competent cells (NZYtech). The empty pGL3-Basic was used as a negative control and pRL-CMV (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and transformed into NZY5α competent cells (Nzytech MB00402). The presence of the mutation and the absence of undesired mutations were confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DtGH67 and SthAraf62A expressing cells in autoinducible medium (NZYtech) supplemented with 50 µg.ml−1 kanamycin ...
-
bioRxiv - Microbiology 2024Quote: ... Assembled products were transformed into NY5α competent cells (NZYtech). Correct insertion was checked by colony PCR using vector-specific primers (Forward ...
-
bioRxiv - Cell Biology 2024Quote: ... total RNA from cells was extracted using either NZYol (NZYTech) or GRS Total RNA Kit (GRiSP) ...
-
bioRxiv - Cancer Biology 2021Quote: ... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
bioRxiv - Microbiology 2023Quote: ... Isopropyl β-D-1-thiogalactopyranoside (IPTG) was purchased from NZYTech (MB026). The anti-human NF-κB p65 C-terminal domain (c-20 ...
-
bioRxiv - Molecular Biology 2020Quote: RNA extracts were obtained from cells using NZY Total RNA Isolation kit (Nzytech) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was isolated from HeLa cells using NZYol reagent (NZYTech, Lisboa, Portugal). RNA concentration was determined using the DS-11 Series Spectrophotometer / Fluorometer (DeNovix ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was extracted from cells using NZYOL™ RNA Isolation Reagent (NZYTech) and treated with DNase I (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... the cells were transferred to gelrite plates containing kanamycin (100mg/L) (NZYTech, Portugal) and ticarcillin disodium/clavulanate potassium (500mg/L ...
-
bioRxiv - Cell Biology 2023Quote: RNA extracts were obtained from cells using NZY Total RNA Isolation kit (Nzytech) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were then blocked with 1,5% bovine serum albumin (BSA, NZYTech, Lisbon, Portugal) for two hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: First-strand cDNA was synthesized from 1 μg of total RNA using reverse trancriptase (NZYtech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells harbouring these various plasmids were individually encapsulated in autoinducible medium (AIM, [NZYtech, Lisboa, Portugal]) supplemented with 50 µg.mL−1 kanamycin using the flow focussing device shown in Supplementary Figure S3C ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA (1 μg) was reversely transcribed using the NZYTech Reverse Transcriptase cDNA Synthesis kit (NZYTech, Portugal) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was prepared from 1 μg of total RNA with NZY First-Strand cDNA Synthesis Kit (NZYTech). Quantitative real-time PCR was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was prepared from 1 μg of total RNA with NZY-First Strand cDNA Synthesis Kit (NZYTech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21-DE cells containing the respective plasmids were grown on NZY Auto-induction LB medium (NZYTech, Lisbon, Portugal) at 37°C for 20 h ...
-
bioRxiv - Bioengineering 2020Quote: ... Agarose gels were prepared in TAE buffer (1% w/v) and visualized using GreenSafe® Premium (NZYtech, Portugal). Polyplex formulations were loaded in each well and electrophoresis was carried out for approximately 60 minutes at +90 mV ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
bioRxiv - Cell Biology 2023Quote: ... For cloning the amplified fragments we used the NZY-A PCR cloning kit and NZYStar Competent Cells (refs. MB053 and MB00501 NZYTech, Portugal). Inserts contained in recombinant plasmids were sequenced as described above using plasmid based primers T7 (TAATACGACTCACTATAGGG ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out using primers listed in Supplementary Table 1 (relate to all figures) and Taq polymerase (NZYTech).
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of RNA was used for reverse transcription into complementary DNA (cDNA) using NZY Reverse Transcriptase enzyme (NZYTech #MB124) and random hexamer mix (NZYTech #MB12901 ...