Labshake search
Citations for Nzytech :
51 - 96 of 96 citations for Cystatin C ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: RNA was extracted from infected plant tissue using NZY Total RNA Isolation Kit (NZYTech, Portugal) following the described protocol and using a 30 mg quantity of plant material for extraction ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription was carried out using ‘NZY T7 High Yield RNA Synthesis kit’ (NZYtech) following manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... NA cDNA was produced using NZY M-MulV First-Strand cDNA Synthesis Kit (NZYTech, MB17302) with primer “NA_Fw_HindIII” following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2023Quote: ... First-strand cDNA synthesis was performed using the NZYtech First-strand cDNA Synthesis Kit (NZYtech). 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription (RT) was performed using the NZY first strand cDNA synthesis kit (NZYTech, MB12502). Real-time RT-PCR was prepared in 384-well ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was isolated using NZY Total RNA Isolation kit with on-column DNAse treatment (NZYtech). Quality control (Agilent Bioanalyzer 2100) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA of the resulting viral stock was extracted using the Viral RNA Isolation kit (NZYTech). The concentration of viral RNA was then determined by RT-qPCR using a standard curve ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from the five tissues with NZY Total RNA isolation kit (NZYtech) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription (RT) was performed using the NZY MuLV first strand cDNA synthesis kit (NZYTech, MB17302). Real-time RT-PCR to detect GAPDH ...
-
bioRxiv - Plant Biology 2021Quote: ... and first strand cDNA synthesis was performed using the NZY First-Strand cDNA Synthesis Kit (NZYTech). In all cases ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was obtained from RNA samples by using the NZY First-Strand cDNA Synthesis Kit (NZYtech) according to the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We used 4μg of RNA to synthesize cDNA with NZY First-Strand cDNA Synthesis Kit (NZYTech), following manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... RNA was reverse transcribed into cDNA using the NZY First-Strand cDNA Synthesis Kit (NZYTech, MB13402). For each reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... viral stocks were prepared and RNAs extracted for stock normalization using Viral RNA Isolation kit (NZYTech) and for RNA-seq using Trizol (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
bioRxiv - Neuroscience 2023Quote: ... Total mRNA and total miRNA were reverse-transcribed by the NZY First-Strand cDNA Synthesis Kit (NZYTech, Lda ...
-
bioRxiv - Microbiology 2023Quote: ... Isopropyl β-D-1-thiogalactopyranoside (IPTG) was purchased from NZYTech (MB026). The anti-human NF-κB p65 C-terminal domain (c-20 ...
-
bioRxiv - Cell Biology 2021Quote: ... We used 100 ng of RNA for retrotranscription using NZY M-MuLV First-Strand cDNA synthesis kit (NZYtech). Real-time quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2023Quote: RNA from FAC-Sorted EdU+ cells (neural cells >650,000) was isolated by NZY Total RNA Isolation kit (NZYTech) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNA was synthesized from a total of 250-1,000 ng of RNA using the NZY Fisrt-Strand cDNA synthesis kit (NZYTech). Primers used for RT-qPCR experiments are listed in Additional File 2D ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... cDNA was synthesized from a total of 250-1,000 ng of RNA using the NZY Fisrt-Strand cDNA synthesis kit (NZYTech).
-
bioRxiv - Systems Biology 2023Quote: ... Blood from the tail vein of infected mice was collected in 200μL of 1x PBS and genomic DNA was isolated using the NZY Blood gDNA Isolation Kit (NZYTech), according to manufacturer’s guidelines (Extended Data Figure 7 ...
-
bioRxiv - Evolutionary Biology 2024Quote: For sequencing the genome and 5’ ends of JUv2572_vlc RNA was extracted using the Viral RNA Isolation Kit (NZYTech) following manufacturer instructions.
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted and purified from stool samples of COVID-19 patients using the NZY Tissue gDNA Isolation Kit (NZYTech). All 16S DNA libraries (V3 and V4 regions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg of total RNA extracted from 13-day-old seedlings was used for cDNA synthesis using the NZY First-Strand cDNA Synthesis kit (NZYTech) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from dissected NAc samples using the NZY RNA Total Isolation kit (ref. MB13402, Nzytech, Lisboa, Portugal), and purified mRNA samples were reverse transcribed using the SuperScript IV First-strand cDNA synthesis kit (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from evolution passage five (aerial) infected plant tissue using NZY Total RNA Isolation Kit (NZYTech, Lisbon, Portugal). The quality of the RNAs used to prepare RNA-Seq libraries was checked with the Qubit RNA BR Assay Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... from 10 ng of RNA was performed using the One-step NZYTECH RT-qPCR Green kit according to manufactureŕs protocol (NZYTECH, MB34302). RT-PCR was normalized using the housekeeping genes hypoxanthine phosphoribosyl-transferase 1 (HPRT1 ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was extracted from the tissue after mechanical trituration following the manufactureŕs protocol (NZYTECH Total RNA Isolation kit protocol (NZYTECH, MB13402). RNA concentration was measured by spectrophotometry using the Nanodrop 2000c spectrophotometer (Thermo-Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: Samples from four equidistant time series of each evolutionary lineage were collected to extract RNA using the NZY Viral RNA Isolation kit (NZYTech) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Reverse transcription was performed from 500 ng of total RNA using the NZY First-Strand cDNA Synthesis Kit (NZYTech, Lisbon, Portugal) in a reaction volume of 20 μL using a thermocycler GeneAmp PCR System 9700 (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... 1-5 μg total RNA was used for cDNA synthesis using the NZY First-strand cDNA Synthesis Kit (ref. MB40001, NZYTech, Portugal), primed with a mix of oligo (dT)18 to enrich the samples with cDNA from mature mRNAs and hexamers ...
-
bioRxiv - Cell Biology 2023Quote: ... For cloning the amplified fragments we used the NZY-A PCR cloning kit and NZYStar Competent Cells (refs. MB053 and MB00501 NZYTech, Portugal). Inserts contained in recombinant plasmids were sequenced as described above using plasmid based primers T7 (TAATACGACTCACTATAGGG ...
-
bioRxiv - Microbiology 2024Quote: DNA was isolated from spleen (10 mg) and ear skin (20 mg) using the NZYTech Tissue gDNA isolation kit (NZYTech, Portugal) and following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The extractions were performed starting from 50 mg of each biopsy performed with the NZyol Kit following manufacturer instructions (Nzytech genes & enzymes). Microarray hybridization was carried out at High Technology Unit (UAT ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted as described (Siebers et al., 2017) and cDNA was generated using the NZY Fist-Strand cDNA Synthesis kit (NZYTech-Genes & Enzymes), following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The antibiotic resistance cassette together with genome flanking regions (∼600 bp) were amplified and PCR products were purified using the NZYGelpure kit (NZYTech, Lisbon, Portugal). These PCR fragments were transformed into B ...
-
bioRxiv - Molecular Biology 2019Quote: First-strand cDNA was synthesized from 1 μg of total RNA using reverse trancriptase (NZYtech) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was extracted from 50 mg of frozen muscle or lymph node using a NZY Tissue gDNA Isolation kit (NZYTech, Lda. - Genes and Enzymes) following the manufacturers protocol and stored at -20º C for further analysis.
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were produced as periplasmic components in 1 L of the NZY Auto-Induction TB medium (NZytech) according to the manufacturer’s recommendations and were purified by immobilized metal affinity chromatography on a HiTrap TALON® crude 1 mL column (Cytiva) ...
-
bioRxiv - Bioengineering 2020Quote: ... Agarose gels were prepared in TAE buffer (1% w/v) and visualized using GreenSafe® Premium (NZYtech, Portugal). Polyplex formulations were loaded in each well and electrophoresis was carried out for approximately 60 minutes at +90 mV ...
-
bioRxiv - Microbiology 2023Quote: ... mk+) supE44 thi-1 recA1 gyrA96 relA1 lac[F′ proA+B+ lacIq ΔlacZM15:Tn10(TcR)]) chemically competent cells (NZYtech) were used as an intermediate host for cloning purposes and they were grow in LB medium at 37 °C under agitation ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out using primers listed in Supplementary Table 1 (relate to all figures) and Taq polymerase (NZYTech).
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of RNA was used for reverse transcription into complementary DNA (cDNA) using NZY Reverse Transcriptase enzyme (NZYTech #MB124) and random hexamer mix (NZYTech #MB12901 ...