Labshake search
Citations for The Jackson Laboratory :
1 - 50 of 73 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... miR-17∼92fl/fl mice (miR-17∼92fl/fl, The Jackson Laboratory, JAX ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped with primer sets suggested by Jackson labs.
-
bioRxiv - Immunology 2022Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for CD4cre ...
-
bioRxiv - Immunology 2021Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for Eomes ...
-
bioRxiv - Neuroscience 2023Quote: ... The recommended primers and PCR protocols designed by Jackson laboratories were used to verify the transgenes (primers purchased from Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers and PCRs were done as specified by protocols by Jackson Laboratory. Identification of intact Tet2 (Protocol 19042 ...
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Microbiology 2021Quote: ... The heterozygous mice were crossed and genotyped to select heterozygous mice for experiments by using the primer sets recommended by Jackson Laboratory.
-
bioRxiv - Cell Biology 2020Quote: ... Ubc-CreERT2 mice (17) (Jackson Laboratory) were cross-bred with Atg7flox/flox mice (14) ...
-
bioRxiv - Physiology 2020Quote: ... floxed miR-150 mice (STOCK Mir150tm1Mtm/Mmjax mice from Jackson Laboratories) C57/Bl6 background were crossed with C57/Bl6 mice carrying tamoxifen-inducible Cre recombinase under the control of the Cdh5 promoter (Cdh5(PAC)-iCreERT2 (Wang ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tifab−/-;miR-146a−/- mice were crossed with Trp53−/- mice (Jackson Laboratories, 002101). All mice were bred ...
-
bioRxiv - Immunology 2019Quote: ... The Foxp3YFPiCre mice were obtained from Jackson Laboratories (17). The Id2 floxed mice were a gift from Anna Lasorella (Columbia University) ...
-
bioRxiv - Immunology 2021Quote: ... Sle1b mice [detailed previously (41)] were crossed to miR-21KO mice (Jackson Laboratory stock #016856) to generate Sle1b.miR-21KO ...
-
bioRxiv - Physiology 2023Quote: ... Genotyping was performed in-house by PCR from tail snip DNA samples using guidelines and primer sequences from Jackson Laboratory, or was performed by Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped to verify igfrf/f homozygosity and igfap-Cre/ERT or icamk2a-cre/ERT2 expression using the primers and suggested PCR protocols designed by Jackson laboratories, as previously reported (Prabhu ...
-
bioRxiv - Neuroscience 2023Quote: ... 21 mouse lines were used for experiments in this study and genotyping was performed using primers and polymerase chain reaction (PCR) conditions listed on the vendor website (Jackson labs). All animals were maintained on the C57BL6/L background ...
-
bioRxiv - Neuroscience 2022Quote: Male and female C57BL/6J mice (8-17 weeks old; Jackson Labs) were housed in groups of 3-5 littermates with ad libitum access to food and water under a 12h/12h light/dark cycle (lights on from 9:00 am to 9:00 pm) ...
-
bioRxiv - Neuroscience 2020Quote: ... We used either DAT::IRES-Cre mice (n=17, The Jackson Laboratory strain 006660 ...
-
bioRxiv - Cell Biology 2022Quote: 17-18-month-old male C57BL/6 mice obtained from Jackson Laboratories were housed under specific pathogen-free conditions with food and water ad libitum ...
-
bioRxiv - Physiology 2019Quote: ... The DNA purified from the tails was used in PCR reactions for genotyping of mice in the SLAMF6 locus on chromosome 1 (primers adapted from the Jackson laboratories website) and in the Pmel-1 locus on chromosome 2 (Ji et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Ts65Dn (Ts(17(16))65Dn) was purchased from Jackson Laboratory (Stock No: 005252) and maintained by crossing with C57BL/C3H F1 hybrid males ...
-
bioRxiv - Neuroscience 2020Quote: Twelve mice (five females and seven males, C57BL/6, Jackson Laboratory, 6-17 months) were co-housed with their siblings ...
-
bioRxiv - Neuroscience 2022Quote: Adult (17-24 months old) male C57BL/6 mice (The Jackson Laboratory, Bar Harbor, ME) were used in these experiments ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Microbiology 2020Quote: C57BL/6J and K18-hACE2 [B6.Cg-Tg(K18-ACE2)2Prlmn/J (17)] were purchased from Jackson Laboratory. K18-hACE2 mice were anesthetized using 30% vol/vol isoflurane diluted in propylene glycol (30% isoflurane ...
-
bioRxiv - Molecular Biology 2023Quote: PDGFRα-CreER mice (17) and HSA-CreTg/+ mice (18) were purchased from Jackson Laboratories (Strain #: 018280 and 006149). ARL2/Ymice have been described previously (19) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Conditionally floxed AGO2 (ref.17) (AGO2fl/fl) mice and p53fl/+ mice were purchased from Jackson labs (Bar Harbor, Maine). PCR genotyping for KRASG12D;p48Cre ...
-
bioRxiv - Neuroscience 2022Quote: 5.5 month-old male APPswe/PSEN1dE9 mice (Jankowsky, Fadale et al. 2004) (APP/PS1; The Jackson Laboratory; n=17) and age-matched wildtype B6C3 control mice (n=17 ...
-
bioRxiv - Cell Biology 2021Quote: mgWAT from RT or cold exposed mice (Jackson Laboratory, #000664) was fixed in 10% formalin overnight ...
-
bioRxiv - Developmental Biology 2020Quote: We originally obtained ASPP2 mutant mice in which exons 10–17 were replaced with a neo-r gene23from Jackson Laboratory. After careful characterisation of this mouse line ...
-
bioRxiv - Neuroscience 2021Quote: ... Genotyping was performed at weaning using primer sequences published by Jackson laboratories. Male and female mice were used in all experiments ...
-
bioRxiv - Bioengineering 2021Quote: ... 2×105 MDA-MB-231 cells stably expressing LifeAct-GFP were injected into the fourth inguinal mammary fat pads of 17-21 week-old female NSG mice (The Jackson Laboratory). Orthotopic tumors were intravitally imaged for collagen and LifeAct-GFP by an Olympus FVMPE-RS upright microscope with Spectra-Physics Insight DS+ laser ...
-
bioRxiv - Neuroscience 2020Quote: 10-17 week old (12 ± 2 weeks, mean ± s.d., N = 45 mice) male C57BL/6J mice (Jackson laboratories, Bar Harbor, ME) were anesthetized with isoflurane (3% induction ...
-
bioRxiv - Developmental Biology 2022Quote: ... and [mK17 5’]-GFP mice which express GFP under the Keratin 17 promoter and visualize the tooth epithelium (023965, Jackson Laboratories).
-
bioRxiv - Neuroscience 2023Quote: ... in which exons 17 and 18 of the Tsc1 gene are flanked by loxP sites (Tsc1flox/+; JAX:005680, The Jackson Laboratory) were used in this study ...
-
bioRxiv - Immunology 2022Quote: ... were bred in house from breeders set up with C57BL6 mice purchased from Jackson Laboratory (Harbor, ME). Beddings of the cages harboring young and aged mice were exchanged once per week for at least 4 consecutive weeks to ensure the homogenization of microbiota ...
-
bioRxiv - Developmental Biology 2020Quote: ... transgenic animals were utilized by crossing 129S4/SvJae mice containing LoxP sites inserted around exon 17 in the TRPM7 gene (TRPM7fl/fl, STOCK Trpm7tm1Clph/J, The Jackson Laboratory, 018784) [35] with various Cre-recombinase lines ...
-
bioRxiv - Neuroscience 2020Quote: Tsc1 floxed mice with loxP sites flanking exons 17 & 18 of Tsc1 gene (Tsc1flox/flox) were purchased from Jackson Laboratories (Cat# 005680). Two separate driver mouse lines expressing Cre recombinase ...
-
bioRxiv - Neuroscience 2021Quote: ... Experimental mice were generated by first mating the Kcnt1Y777H knockin line 17 to the Snap25-GCaMP6s line (Jackson Labs Stock No: 025111).33 Double heterozygous offspring were then mated to generate mice carrying the Snap25-GCaMP6s construct that were either homozygous Y777H or WT at the Kcnt1 locus ...
-
bioRxiv - Cell Biology 2022Quote: ... All mice were genotyped for Nox4 using primer sequences provided by Jackson Laboratory, and for Ltbp4 and mdx alleles using published genotyping primers (16).
-
bioRxiv - Neuroscience 2022Quote: ... Mice tail samples were genotyped using the following primers suggested by Jackson Laboratories: Piezo1-28247-forward ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping for Cas9 transgene was performed with primer sequences provided by Jackson laboratories. All experiments were performed with approval of a local ethics committee (Bezirksamt Arnsberg ...
-
bioRxiv - Neuroscience 2023Quote: ... stock number: 008683) and primer sequences for genotyping were provided by Jackson laboratories. This breeding setup allowed us to use experimental cohorts that contained litter- and sex-matched mice randomly assigned to experimental groups ...
-
bioRxiv - Neuroscience 2020Quote: ... we set up timed matings of wild-type C57BL/6J mice (000664, The Jackson Laboratory, Bar Harbor, ME). At embryonic day (E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Breeding was set up between Chchd10S55Lheterozygous (Het) males with wildtype (WT) C57BL/6NJ females (Jackson Laboratory, stock #005304). Tail DNA was extracted with a Promega kit and genotype was determined by sequencing services at Transnetyx ...
-
bioRxiv - Neuroscience 2022Quote: ... and Glp1r-Cre heterozygotes crossed with homozygotic B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J mice (Madisen et al., 2010) (N=17; 19 males, 6 females, “Glp1r-Cre;Ai9”; The Jackson Laboratory, strain #007909) were used in the present study ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
bioRxiv - Neuroscience 2021Quote: Adult C57/BL/6J male and female mice (n= 17, male n=9, female n=8; 8 weeks old) purchased from Jackson Labs (Bar Harbor, ME) were single housed on a reverse light cycle (11PM-11AM lights on) ...
-
bioRxiv - Neuroscience 2021Quote: ... Tsc1c/c mice possess loxP sites flanking exons 17 and 18 of the Tsc1 gene (stock# 005680) and were obtained from Jackson labs (Kwiatkowski et al., 2002). The Rosa26fsTRAP mouse line (stock# 022367 ...