Labshake search
Citations for The Jackson Laboratory :
1 - 50 of 333 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
bioRxiv - Physiology 2023Quote: ... Breeding pairs were obtained from Jackson Laboratory and backcrossed for 8 generations.
-
bioRxiv - Neuroscience 2024Quote: ... Breeding pairs were obtained from Jackson Laboratory and backcrossed for 8 generations ...
-
bioRxiv - Cancer Biology 2024Quote: ... established by breeding pairs purchased from Jackson Laboratories. All procedures were reviewed and approved by UCI Institutional Animal Care Use Committee ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were bred from homozygous pairs (Jackson Labs) in the University of Manchester Biological Services Facility ...
-
bioRxiv - Microbiology 2020Quote: ... Breeding pairs were purchased from Jackson laboratories (Bar Harbor, Maine) and maintained under pathogen-free conditions in the UCSF barrier facility ...
-
bioRxiv - Physiology 2021Quote: ... Breeding pairs were purchased from Jackson Laboratories (Bar Harbor, ME). Mice were housed with free access to food and water for the duration of the study (humidity 50±10% ...
-
bioRxiv - Molecular Biology 2021Quote: ... The original breeding pairs of WT were from Jackson Laboratories, Tmem173-/- were donated by Daniel Stetson at the University of Washington 65 ...
-
bioRxiv - Physiology 2022Quote: ... Cd36ko breeding pairs were purchased from Jackson Laboratory (cat. 019006). For the experiments ...
-
bioRxiv - Immunology 2023Quote: ... As the original Irak3-/- breeding pairs purchased from Jackson Laboratory (strain B6.129S1-Irak3tm1Flv/J ...
-
bioRxiv - Neuroscience 2022Quote: ... Human alpha-syn(A53T) transgenic G2-3 lines are available from Jackson Laboratory (13) were aged and late symptomatic mice were used for biochemical analysis and isolation of endogenous A53T α-syn aggregates ...
-
bioRxiv - Neuroscience 2020Quote: C57Bl6J breeder pairs were obtained from Jackson Laboratories (Bar Harbor, ME). Transgenic Dat-Ires-Cre Ai38 mice were generated as described (Lieberman et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Esr1 and Esr2 breeding pairs were also obtained from Jackson laboratories. Esr2-icre knock-in (Esr2-icre ...
-
bioRxiv - Neuroscience 2024Quote: ... with founder breeding pairs obtained from Jackson Laboratories (Bar Harbor, ME). Three separate sets of cohort groups were generated ...
-
bioRxiv - Immunology 2023Quote: ... Original breeding pairs were purchased from Jackson Laboratory (Bar Harbor, ME).
-
bioRxiv - Neuroscience 2024Quote: Breeding pairs of R6/2 mice were purchased from Jackson Laboratories [female hemizygous ovarian transplant B6CBA-TgN (HD exon1)62 ...
-
bioRxiv - Neuroscience 2021Quote: ... were bred as homozygous pairs or crossed with Ai9 mice (Jackson Laboratories). Both the Prkcd-cre and VGAT-Cre mouse lines have been previously validated and shown to express Cre selectively in PKCδ+ and GABAergic neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... which were bred in our facility (first breeding pairs from Jackson Labs). These transgenic mice have a tetracycline-transcriptional-transactivator (tTA ...
-
bioRxiv - Microbiology 2023Quote: Breeding pairs of C57BL/6 ifnar −/−/ifngr −/− were purchased from Jackson Laboratories to generate mouse colonies at Tonix Pharma ...
-
bioRxiv - Neuroscience 2024Quote: ... while wild-type C57BL6/J mice (original breeding pairs from Jackson lab) were used for brain slice electrophysiology experiments ...
-
bioRxiv - Immunology 2023Quote: NSG mice (breeder pairs obtained from The Jackson Laboratory, breeding in house) between 8-12 weeks of age were subcutaneously (in the flank ...
-
bioRxiv - Genetics 2021Quote: ... Slc7a8 (Slc7a8tm1Dgen) heterozygous and wildtype C57BL/6J mating pairs obtained from Jackson Laboratory (Bar Harbor ...
-
bioRxiv - Neuroscience 2020Quote: ... Founder breeding pairs (JAX 000671) were obtained from Jackson Labs (Bar Harbor, ME) and our colony was maintained in micro-isolator facilities in the institutional vivarium ...
-
bioRxiv - Microbiology 2020Quote: ... Breeding pairs of NSG mice were obtained from Jackson Laboratories (Bar Harbor, ME), and were bred and maintained at VRI in a vivarium free from >40 murine pathogens as determined through biannual nucleic acid testing (Mouse Surveillance Plus PRIA ...
-
bioRxiv - Immunology 2021Quote: ... Tg(IghelMD4)4Ccg/J breeding pairs were purchased from Jackson Laboratory (Stock No: 002595) and mated in-house ...
-
bioRxiv - Neuroscience 2021Quote: ... A colony of Drd1a-tdTomato mice (initial breeding pairs obtained from The Jackson Laboratory, (IMSR Cat# JAX:016204 ...
-
bioRxiv - Immunology 2023Quote: Breeding pair of Wild type (Wt) and Irg1 KO were purchased from Jackson Laboratory and maintained in Institutional animal facility ...
-
bioRxiv - Cell Biology 2024Quote: C57BL6/J breeding pairs were purchased from Jackson Laboratories (stock # 00664, Bar Harbor, ME). Retinas were collected at P7 ...
-
bioRxiv - Cell Biology 2020Quote: ... we procured the breeding pairs of C57BL/6 mice (The Jackson Laboratories, Bar Harbor, ME) and paired male and female mice of around four weeks of age ...
-
bioRxiv - Genetics 2021Quote: C57BL/6 mice and mating pairs of rd12 mice (stock no. 005379, The Jackson Laboratory) were purchased from Central Laboratory Animal and maintained under a 12-hour dark-light cycle ...
-
bioRxiv - Developmental Biology 2022Quote: ... and C3aR mutant (referred as KO) (stock # 033904) breeding pairs were purchased from Jackson Laboratories. C3 KO and C3aR KO mice were crossed to C57BL6/J mice to create a heterozygous line ...
-
bioRxiv - Neuroscience 2023Quote: ... that were bred in house from breeding pairs obtained from Jackson Laboratory (JAX stock # 033168).
-
bioRxiv - Neuroscience 2020Quote: ... Original breeding pairs of Chat-Cre(B6;129S6-Chattm1(cre)Lowl/J) were obtained from Jackson Laboratory, (Maine ...
-
bioRxiv - Neuroscience 2021Quote: ... Mating pairs of wild-type C57BL/6J mice were purchased from Jackson Laboratories (Bar Harbor, ME). All mice had free access to rodent chow and water in a 12-hour dark-light cycle room.
-
bioRxiv - Physiology 2022Quote: ... A heterozygous APOE3 breeding pair (B6.Cg-Apoeem2(APOE*)Adiuj/J) was purchased from Jackson Laboratory, Bar Harbor ...
-
bioRxiv - Neuroscience 2024Quote: ... Breeding pairs consisted of C57BL6/J females (Jax 000664) and SOD1G93A males purchased from Jackson laboratories, where they were assessed for transgene copy number maintenance ...
-
bioRxiv - Immunology 2023Quote: ... C;129S4-Rag2tm1.1Flv- Il2rgtm1.1Flv/J (RAG2gc KO) and breeding pairs were originally purchased from Jackson Laboratory and bred under specific pathogen free conditions ...
-
bioRxiv - Neuroscience 2023Quote: Twitcher (twi) mice and wild-type (WT) littermates were obtained from heterozygous breeding pairs (Jackson Laboratory). Genotyping of Twitcher mice was based on the use of a PCR mismatched primer that creates a restriction site for EcoRV if the Galc allele possesses the mutation ...
-
bioRxiv - Neuroscience 2020Quote: Male and female 3xTg-AD breeder pairs (#34830-JAX) were obtained from Jackson Laboratories (Bar Harbor, Maine) and were used to breed male and female 3xTg-AD mice for this experiment ...
-
bioRxiv - Genetics 2020Quote: ... B6J x D2J-F1 mice (15 breeder pairs) were purchased from Jackson Laboratory (JAX; Bar Harbor, ME) and were habituated in the colony for one week prior to breeding in-house to generate 128 B6J x D2J-F2 mice for experimental testing.
-
bioRxiv - Neuroscience 2022Quote: ... The transgenic mice were bred in-house after the breeding pairs were initially obtained from Jackson Laboratory. Additionally ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Physiology 2022Quote: ... Breeding pairs were originally purchased from The Jackson Laboratory (The Jackson Laboratory; Thy-1 YFP-16, Stock# 003709). Mice were bred from homozygous breeding pairs and were fed a standard laboratory diet ad libitum ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Breeding pairs of C57/B6 and Pparα-null (Pparα-/-) mice were obtained from Jackson Laboratory (Bar Harbor, ME). ATF4 liver conditional knockout mice (Atf4ΔHep ...
-
bioRxiv - Physiology 2022Quote: ... A homozygous APOE4 breeding pair (B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J) was also purchased from Jackson Laboratory. Mice were fed a standard chow diet (Teklad 2018 ...
-
bioRxiv - Microbiology 2021Quote: ... C57BL/6 mice defective for the interferon alpha/beta receptor (IFNAR-/-) were obtained from Jackson Laboratories and all experimental mice were 8-to 12-weeks old ...
-
bioRxiv - Genetics 2020Quote: ... Breeding pairs of spf-ash mice (B6EiC3Sn a/A-OTCSpf-Ash/J) were purchased from Jackson Laboratories (Cat# 001811) and housed in individually ventilated cages ...
-
bioRxiv - Immunology 2022Quote: ... Breeding pairs of B6.129S2-Tcratm1Mom/J (TCRα KO) and B6.SJL-PtprcaPepcb/BoyJ (CD45.1) mice were purchased from Jackson Laboratories. Congenic CD45.1 mice were backcrossed with CD43-/- mice (kindly provided by Pilar Alcaide ...
-
bioRxiv - Neuroscience 2022Quote: ... Male and female C57BL/6J (C57) mice were bred at Augustana University using breeding pairs obtained from Jackson Laboratories, Bar Harbor ...
-
bioRxiv - Immunology 2023Quote: ... Rag1 KO-/- were generated by breeding 10 Male and 10 Female B6.129S7-Rag1 (homozygous for Rag1) breeding pairs from Jackson Laboratory. For immune characterization of the peripubertal DHT-induced PCOS mice ...